rabbit polyclonal anti-homer1 160–003 (Synaptic Systems)
Synaptic Systems is a verified supplier 
Synaptic Systems manufactures this product 
90
Structured Review
Synaptic Systems
rabbit polyclonal anti-homer1 160–003
Rabbit Polyclonal Anti Homer1 160–003, supplied by Synaptic Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rabbit+polyclonal+anti-homer1/homer1+antibody/pmc11896613-26-2-6
Average 90 stars, based on 1 article reviews
Rabbit Polyclonal Anti Homer1 160–003, supplied by Synaptic Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rabbit+polyclonal+anti-homer1/homer1+antibody/pmc11896613-26-2-6
Average 90 stars, based on 1 article reviews
rabbit polyclonal anti-homer1 160–003 - by Bioz Stars,
2026-09
90/100 stars
Images
1) Product Images from "Translatome analysis reveals cellular network in DLK-dependent hippocampal glutamatergic neuron degeneration"
Article Title: Translatome analysis reveals cellular network in DLK-dependent hippocampal glutamatergic neuron degeneration
Journal: eLife
doi: 10.7554/eLife.101173
Figure Legend Snippet:
Techniques Used: Knock-Out, Over Expression, Sequencing, RNAscope, TUNEL Assay, SYBR Green Assay, Bicinchoninic Acid Protein Assay, Multiplex Assay, Software
Related Articles
Recombinant:Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The dilution ratio of primary antibodies was as follows: Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: After sections were washed with PBS (10 min × 2) and blocking solution (20 min × 1), DyLight405 anti-guinea pig (Jackson ImmunoResearch Laboratories), Alexa Fluor 488 anti-chicken (Jackson ImmunoResearch Laboratories), and Alexa Fluor 594 anti-rabbit (Jackson ImmunoResearch Laboratories) were added to samples at a dilution of 1:800 for secondary antibody incubation at room temperature for 1 h. The immunostained slides were mounted with ProLong Gold antifade reagent (Life Technologies) and cured for 24 h. Fluorescent images of immunostained sections were acquired at 5×, 40×, and 63× magnifications with a Zeiss LSM 880 confocal microscope. Article Title: The synaptic basis of activity-dependent eye-specific competition. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Donkey anti-Guinea pig IgG unconjugated (1:100) Jackson ImmunoResearch Cat#706-005-148; RRID: AB_2340443 Donkey anti-Mouse IgG unconjugated (1:100) Jackson ImmunoResearch Cat#715-005-150; RRID: AB_2340758 Donkey anti-Rabbit IgG unconjugated (1:100) Jackson ImmunoResearch Cat#711-005-152; RRID: AB_2340585 Guinea pig polyclonal anit-VGluT2 (1:100) Millipore Sigma AB2251-I; RRID: AB_2665454 Mouse monoclonal anti-Bassoon (1:100) Abcam Ab82958; RRID: AB_1860018 Rabbit polyclonal anti-Homer1 (1:100) Synaptic Systems Cat#160 003; RRID: AB_887730 Chemicals, peptides, and recombinant proteins Alexa Fluor 405 NHS-ester Thermo Fisher Scientific Cat#A30000 Alexa Fluor 647 NHS-ester Thermo Fisher Scientific Cat#A20006 Atto 488 NHS-ester ATTO-TEC GmbH AD 488–31 Catalase from bovine liver Sigma-Aldrich C1345 Chloroform Sigma-Aldrich Cat#288306 Cy-3B Mono NHS-ester Cytiva PA63101 Cysteamine Sigma-Aldrich Cat#30070 DY-749P1 NHS-ester Dyomics GmnH Cat#749P1-01 Dulbecco’s Phosphate Buffered Saline Sigma-Aldrich D8662 Ethanol Pharmco Cat#111000200C1GL FluoSpheres Infrared (715/755) Invitrogen Cat#F8799 FluoSpheres Orange (540/560) Invitrogen Cat#F8809 D-(+)-Glucose Sigma Aldrich Cat#G7528 Glucose Oxidase Sigma-Aldrich G2133 Glutaraldehyde 70%, EM grade Electron Microscopy Sciences Cat#16360 Normal Donkey Serum Jackson ImmunoResearch Cat#017-000-121 Paraformaldehyde 16%, EM grade Electron Microscopy Sciences Cat#15710 Sodium azide Sigma-Aldrich S2002 Sodium chloride Sigma-Aldrich S9888 Sodium hydroxide pellets Sigma-Aldrich Cat#567530 Tris-base (Trizma-base) Sigma-Aldrich T8524 Triton X-100 Sigma-Aldrich Cat#11332481001 Critical commercial assays UltraBed Kit Electron Microscopy Sciences Cat#14310 Experimental models: Organisms/strains Mouse: C57BL/6J Age: 2–8 days; Sex: M/F The Jackson Laboratory Cat#000664 Mouse: b2-nAChR / Age: 2–8 days; Sex: M/F Burbridge et al.104 N/A Oligonucleotides Primer: nAChR forward: CAGGCGTT ATCCACAAAGACAGA Burbridge et al.104 N/A Primer: nAChR reverse: TTGAGGGG AGCAGAACAGAATC Burbridge et al.104 N/A Primer: nAChR mutant reverse: ACTTGGGTTTGGGCGTGTTGAG Burbridge et al.104 N/A (Continued on next page) 14 Cell Reports 42, 112085, February 28, 2023 Article Title: Phosphorylation-dependent membraneless organelle fusion and fission illustrated by postsynaptic density assemblies. Article Snippet: Article Article Title: Presynaptic activity and protein turnover are correlated at the single-synapse level. Article Snippet: REAGENT or Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The blocked membranes from both in vivo and in vitro experiments were probed with following primary antibodies: Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal antiBassoon at 1:1000 ( Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal anti-Bassoon at 1:1000 ( Atomic Absorption Spectroscopy:Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The dilution ratio of primary antibodies was as follows: Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: After sections were washed with PBS (10 min × 2) and blocking solution (20 min × 1), DyLight405 anti-guinea pig (Jackson ImmunoResearch Laboratories), Alexa Fluor 488 anti-chicken (Jackson ImmunoResearch Laboratories), and Alexa Fluor 594 anti-rabbit (Jackson ImmunoResearch Laboratories) were added to samples at a dilution of 1:800 for secondary antibody incubation at room temperature for 1 h. The immunostained slides were mounted with ProLong Gold antifade reagent (Life Technologies) and cured for 24 h. Fluorescent images of immunostained sections were acquired at 5×, 40×, and 63× magnifications with a Zeiss LSM 880 confocal microscope. Article Title: The synaptic basis of activity-dependent eye-specific competition. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Donkey anti-Guinea pig IgG unconjugated (1:100) Jackson ImmunoResearch Cat#706-005-148; RRID: AB_2340443 Donkey anti-Mouse IgG unconjugated (1:100) Jackson ImmunoResearch Cat#715-005-150; RRID: AB_2340758 Donkey anti-Rabbit IgG unconjugated (1:100) Jackson ImmunoResearch Cat#711-005-152; RRID: AB_2340585 Guinea pig polyclonal anit-VGluT2 (1:100) Millipore Sigma AB2251-I; RRID: AB_2665454 Mouse monoclonal anti-Bassoon (1:100) Abcam Ab82958; RRID: AB_1860018 Rabbit polyclonal anti-Homer1 (1:100) Synaptic Systems Cat#160 003; RRID: AB_887730 Chemicals, peptides, and recombinant proteins Alexa Fluor 405 NHS-ester Thermo Fisher Scientific Cat#A30000 Alexa Fluor 647 NHS-ester Thermo Fisher Scientific Cat#A20006 Atto 488 NHS-ester ATTO-TEC GmbH AD 488–31 Catalase from bovine liver Sigma-Aldrich C1345 Chloroform Sigma-Aldrich Cat#288306 Cy-3B Mono NHS-ester Cytiva PA63101 Cysteamine Sigma-Aldrich Cat#30070 DY-749P1 NHS-ester Dyomics GmnH Cat#749P1-01 Dulbecco’s Phosphate Buffered Saline Sigma-Aldrich D8662 Ethanol Pharmco Cat#111000200C1GL FluoSpheres Infrared (715/755) Invitrogen Cat#F8799 FluoSpheres Orange (540/560) Invitrogen Cat#F8809 D-(+)-Glucose Sigma Aldrich Cat#G7528 Glucose Oxidase Sigma-Aldrich G2133 Glutaraldehyde 70%, EM grade Electron Microscopy Sciences Cat#16360 Normal Donkey Serum Jackson ImmunoResearch Cat#017-000-121 Paraformaldehyde 16%, EM grade Electron Microscopy Sciences Cat#15710 Sodium azide Sigma-Aldrich S2002 Sodium chloride Sigma-Aldrich S9888 Sodium hydroxide pellets Sigma-Aldrich Cat#567530 Tris-base (Trizma-base) Sigma-Aldrich T8524 Triton X-100 Sigma-Aldrich Cat#11332481001 Critical commercial assays UltraBed Kit Electron Microscopy Sciences Cat#14310 Experimental models: Organisms/strains Mouse: C57BL/6J Age: 2–8 days; Sex: M/F The Jackson Laboratory Cat#000664 Mouse: b2-nAChR / Age: 2–8 days; Sex: M/F Burbridge et al.104 N/A Oligonucleotides Primer: nAChR forward: CAGGCGTT ATCCACAAAGACAGA Burbridge et al.104 N/A Primer: nAChR reverse: TTGAGGGG AGCAGAACAGAATC Burbridge et al.104 N/A Primer: nAChR mutant reverse: ACTTGGGTTTGGGCGTGTTGAG Burbridge et al.104 N/A (Continued on next page) 14 Cell Reports 42, 112085, February 28, 2023 Article Title: Phosphorylation-dependent membraneless organelle fusion and fission illustrated by postsynaptic density assemblies. Article Snippet: Article Article Title: Presynaptic activity and protein turnover are correlated at the single-synapse level. Article Snippet: REAGENT or Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The blocked membranes from both in vivo and in vitro experiments were probed with following primary antibodies: Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal antiBassoon at 1:1000 ( Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal anti-Bassoon at 1:1000 ( Saline:Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The dilution ratio of primary antibodies was as follows: Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: After sections were washed with PBS (10 min × 2) and blocking solution (20 min × 1), DyLight405 anti-guinea pig (Jackson ImmunoResearch Laboratories), Alexa Fluor 488 anti-chicken (Jackson ImmunoResearch Laboratories), and Alexa Fluor 594 anti-rabbit (Jackson ImmunoResearch Laboratories) were added to samples at a dilution of 1:800 for secondary antibody incubation at room temperature for 1 h. The immunostained slides were mounted with ProLong Gold antifade reagent (Life Technologies) and cured for 24 h. Fluorescent images of immunostained sections were acquired at 5×, 40×, and 63× magnifications with a Zeiss LSM 880 confocal microscope. Article Title: The synaptic basis of activity-dependent eye-specific competition. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Donkey anti-Guinea pig IgG unconjugated (1:100) Jackson ImmunoResearch Cat#706-005-148; RRID: AB_2340443 Donkey anti-Mouse IgG unconjugated (1:100) Jackson ImmunoResearch Cat#715-005-150; RRID: AB_2340758 Donkey anti-Rabbit IgG unconjugated (1:100) Jackson ImmunoResearch Cat#711-005-152; RRID: AB_2340585 Guinea pig polyclonal anit-VGluT2 (1:100) Millipore Sigma AB2251-I; RRID: AB_2665454 Mouse monoclonal anti-Bassoon (1:100) Abcam Ab82958; RRID: AB_1860018 Rabbit polyclonal anti-Homer1 (1:100) Synaptic Systems Cat#160 003; RRID: AB_887730 Chemicals, peptides, and recombinant proteins Alexa Fluor 405 NHS-ester Thermo Fisher Scientific Cat#A30000 Alexa Fluor 647 NHS-ester Thermo Fisher Scientific Cat#A20006 Atto 488 NHS-ester ATTO-TEC GmbH AD 488–31 Catalase from bovine liver Sigma-Aldrich C1345 Chloroform Sigma-Aldrich Cat#288306 Cy-3B Mono NHS-ester Cytiva PA63101 Cysteamine Sigma-Aldrich Cat#30070 DY-749P1 NHS-ester Dyomics GmnH Cat#749P1-01 Dulbecco’s Phosphate Buffered Saline Sigma-Aldrich D8662 Ethanol Pharmco Cat#111000200C1GL FluoSpheres Infrared (715/755) Invitrogen Cat#F8799 FluoSpheres Orange (540/560) Invitrogen Cat#F8809 D-(+)-Glucose Sigma Aldrich Cat#G7528 Glucose Oxidase Sigma-Aldrich G2133 Glutaraldehyde 70%, EM grade Electron Microscopy Sciences Cat#16360 Normal Donkey Serum Jackson ImmunoResearch Cat#017-000-121 Paraformaldehyde 16%, EM grade Electron Microscopy Sciences Cat#15710 Sodium azide Sigma-Aldrich S2002 Sodium chloride Sigma-Aldrich S9888 Sodium hydroxide pellets Sigma-Aldrich Cat#567530 Tris-base (Trizma-base) Sigma-Aldrich T8524 Triton X-100 Sigma-Aldrich Cat#11332481001 Critical commercial assays UltraBed Kit Electron Microscopy Sciences Cat#14310 Experimental models: Organisms/strains Mouse: C57BL/6J Age: 2–8 days; Sex: M/F The Jackson Laboratory Cat#000664 Mouse: b2-nAChR / Age: 2–8 days; Sex: M/F Burbridge et al.104 N/A Oligonucleotides Primer: nAChR forward: CAGGCGTT ATCCACAAAGACAGA Burbridge et al.104 N/A Primer: nAChR reverse: TTGAGGGG AGCAGAACAGAATC Burbridge et al.104 N/A Primer: nAChR mutant reverse: ACTTGGGTTTGGGCGTGTTGAG Burbridge et al.104 N/A (Continued on next page) 14 Cell Reports 42, 112085, February 28, 2023 Article Title: Phosphorylation-dependent membraneless organelle fusion and fission illustrated by postsynaptic density assemblies. Article Snippet: Article Article Title: Presynaptic activity and protein turnover are correlated at the single-synapse level. Article Snippet: REAGENT or Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The blocked membranes from both in vivo and in vitro experiments were probed with following primary antibodies: Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal antiBassoon at 1:1000 ( Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal anti-Bassoon at 1:1000 ( Electron Microscopy:Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The dilution ratio of primary antibodies was as follows: Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: After sections were washed with PBS (10 min × 2) and blocking solution (20 min × 1), DyLight405 anti-guinea pig (Jackson ImmunoResearch Laboratories), Alexa Fluor 488 anti-chicken (Jackson ImmunoResearch Laboratories), and Alexa Fluor 594 anti-rabbit (Jackson ImmunoResearch Laboratories) were added to samples at a dilution of 1:800 for secondary antibody incubation at room temperature for 1 h. The immunostained slides were mounted with ProLong Gold antifade reagent (Life Technologies) and cured for 24 h. Fluorescent images of immunostained sections were acquired at 5×, 40×, and 63× magnifications with a Zeiss LSM 880 confocal microscope. Article Title: The synaptic basis of activity-dependent eye-specific competition. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Donkey anti-Guinea pig IgG unconjugated (1:100) Jackson ImmunoResearch Cat#706-005-148; RRID: AB_2340443 Donkey anti-Mouse IgG unconjugated (1:100) Jackson ImmunoResearch Cat#715-005-150; RRID: AB_2340758 Donkey anti-Rabbit IgG unconjugated (1:100) Jackson ImmunoResearch Cat#711-005-152; RRID: AB_2340585 Guinea pig polyclonal anit-VGluT2 (1:100) Millipore Sigma AB2251-I; RRID: AB_2665454 Mouse monoclonal anti-Bassoon (1:100) Abcam Ab82958; RRID: AB_1860018 Rabbit polyclonal anti-Homer1 (1:100) Synaptic Systems Cat#160 003; RRID: AB_887730 Chemicals, peptides, and recombinant proteins Alexa Fluor 405 NHS-ester Thermo Fisher Scientific Cat#A30000 Alexa Fluor 647 NHS-ester Thermo Fisher Scientific Cat#A20006 Atto 488 NHS-ester ATTO-TEC GmbH AD 488–31 Catalase from bovine liver Sigma-Aldrich C1345 Chloroform Sigma-Aldrich Cat#288306 Cy-3B Mono NHS-ester Cytiva PA63101 Cysteamine Sigma-Aldrich Cat#30070 DY-749P1 NHS-ester Dyomics GmnH Cat#749P1-01 Dulbecco’s Phosphate Buffered Saline Sigma-Aldrich D8662 Ethanol Pharmco Cat#111000200C1GL FluoSpheres Infrared (715/755) Invitrogen Cat#F8799 FluoSpheres Orange (540/560) Invitrogen Cat#F8809 D-(+)-Glucose Sigma Aldrich Cat#G7528 Glucose Oxidase Sigma-Aldrich G2133 Glutaraldehyde 70%, EM grade Electron Microscopy Sciences Cat#16360 Normal Donkey Serum Jackson ImmunoResearch Cat#017-000-121 Paraformaldehyde 16%, EM grade Electron Microscopy Sciences Cat#15710 Sodium azide Sigma-Aldrich S2002 Sodium chloride Sigma-Aldrich S9888 Sodium hydroxide pellets Sigma-Aldrich Cat#567530 Tris-base (Trizma-base) Sigma-Aldrich T8524 Triton X-100 Sigma-Aldrich Cat#11332481001 Critical commercial assays UltraBed Kit Electron Microscopy Sciences Cat#14310 Experimental models: Organisms/strains Mouse: C57BL/6J Age: 2–8 days; Sex: M/F The Jackson Laboratory Cat#000664 Mouse: b2-nAChR / Age: 2–8 days; Sex: M/F Burbridge et al.104 N/A Oligonucleotides Primer: nAChR forward: CAGGCGTT ATCCACAAAGACAGA Burbridge et al.104 N/A Primer: nAChR reverse: TTGAGGGG AGCAGAACAGAATC Burbridge et al.104 N/A Primer: nAChR mutant reverse: ACTTGGGTTTGGGCGTGTTGAG Burbridge et al.104 N/A (Continued on next page) 14 Cell Reports 42, 112085, February 28, 2023 Article Title: Phosphorylation-dependent membraneless organelle fusion and fission illustrated by postsynaptic density assemblies. Article Snippet: Article Article Title: Presynaptic activity and protein turnover are correlated at the single-synapse level. Article Snippet: REAGENT or Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The blocked membranes from both in vivo and in vitro experiments were probed with following primary antibodies: Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal antiBassoon at 1:1000 ( Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal anti-Bassoon at 1:1000 ( Mutagenesis:Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The dilution ratio of primary antibodies was as follows: Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: After sections were washed with PBS (10 min × 2) and blocking solution (20 min × 1), DyLight405 anti-guinea pig (Jackson ImmunoResearch Laboratories), Alexa Fluor 488 anti-chicken (Jackson ImmunoResearch Laboratories), and Alexa Fluor 594 anti-rabbit (Jackson ImmunoResearch Laboratories) were added to samples at a dilution of 1:800 for secondary antibody incubation at room temperature for 1 h. The immunostained slides were mounted with ProLong Gold antifade reagent (Life Technologies) and cured for 24 h. Fluorescent images of immunostained sections were acquired at 5×, 40×, and 63× magnifications with a Zeiss LSM 880 confocal microscope. Article Title: The synaptic basis of activity-dependent eye-specific competition. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Donkey anti-Guinea pig IgG unconjugated (1:100) Jackson ImmunoResearch Cat#706-005-148; RRID: AB_2340443 Donkey anti-Mouse IgG unconjugated (1:100) Jackson ImmunoResearch Cat#715-005-150; RRID: AB_2340758 Donkey anti-Rabbit IgG unconjugated (1:100) Jackson ImmunoResearch Cat#711-005-152; RRID: AB_2340585 Guinea pig polyclonal anit-VGluT2 (1:100) Millipore Sigma AB2251-I; RRID: AB_2665454 Mouse monoclonal anti-Bassoon (1:100) Abcam Ab82958; RRID: AB_1860018 Rabbit polyclonal anti-Homer1 (1:100) Synaptic Systems Cat#160 003; RRID: AB_887730 Chemicals, peptides, and recombinant proteins Alexa Fluor 405 NHS-ester Thermo Fisher Scientific Cat#A30000 Alexa Fluor 647 NHS-ester Thermo Fisher Scientific Cat#A20006 Atto 488 NHS-ester ATTO-TEC GmbH AD 488–31 Catalase from bovine liver Sigma-Aldrich C1345 Chloroform Sigma-Aldrich Cat#288306 Cy-3B Mono NHS-ester Cytiva PA63101 Cysteamine Sigma-Aldrich Cat#30070 DY-749P1 NHS-ester Dyomics GmnH Cat#749P1-01 Dulbecco’s Phosphate Buffered Saline Sigma-Aldrich D8662 Ethanol Pharmco Cat#111000200C1GL FluoSpheres Infrared (715/755) Invitrogen Cat#F8799 FluoSpheres Orange (540/560) Invitrogen Cat#F8809 D-(+)-Glucose Sigma Aldrich Cat#G7528 Glucose Oxidase Sigma-Aldrich G2133 Glutaraldehyde 70%, EM grade Electron Microscopy Sciences Cat#16360 Normal Donkey Serum Jackson ImmunoResearch Cat#017-000-121 Paraformaldehyde 16%, EM grade Electron Microscopy Sciences Cat#15710 Sodium azide Sigma-Aldrich S2002 Sodium chloride Sigma-Aldrich S9888 Sodium hydroxide pellets Sigma-Aldrich Cat#567530 Tris-base (Trizma-base) Sigma-Aldrich T8524 Triton X-100 Sigma-Aldrich Cat#11332481001 Critical commercial assays UltraBed Kit Electron Microscopy Sciences Cat#14310 Experimental models: Organisms/strains Mouse: C57BL/6J Age: 2–8 days; Sex: M/F The Jackson Laboratory Cat#000664 Mouse: b2-nAChR / Age: 2–8 days; Sex: M/F Burbridge et al.104 N/A Oligonucleotides Primer: nAChR forward: CAGGCGTT ATCCACAAAGACAGA Burbridge et al.104 N/A Primer: nAChR reverse: TTGAGGGG AGCAGAACAGAATC Burbridge et al.104 N/A Primer: nAChR mutant reverse: ACTTGGGTTTGGGCGTGTTGAG Burbridge et al.104 N/A (Continued on next page) 14 Cell Reports 42, 112085, February 28, 2023 Article Title: Phosphorylation-dependent membraneless organelle fusion and fission illustrated by postsynaptic density assemblies. Article Snippet: Article Article Title: Presynaptic activity and protein turnover are correlated at the single-synapse level. Article Snippet: REAGENT or Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The blocked membranes from both in vivo and in vitro experiments were probed with following primary antibodies: Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal antiBassoon at 1:1000 ( Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal anti-Bassoon at 1:1000 ( Software:Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The dilution ratio of primary antibodies was as follows: Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: After sections were washed with PBS (10 min × 2) and blocking solution (20 min × 1), DyLight405 anti-guinea pig (Jackson ImmunoResearch Laboratories), Alexa Fluor 488 anti-chicken (Jackson ImmunoResearch Laboratories), and Alexa Fluor 594 anti-rabbit (Jackson ImmunoResearch Laboratories) were added to samples at a dilution of 1:800 for secondary antibody incubation at room temperature for 1 h. The immunostained slides were mounted with ProLong Gold antifade reagent (Life Technologies) and cured for 24 h. Fluorescent images of immunostained sections were acquired at 5×, 40×, and 63× magnifications with a Zeiss LSM 880 confocal microscope. Article Title: The synaptic basis of activity-dependent eye-specific competition. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Donkey anti-Guinea pig IgG unconjugated (1:100) Jackson ImmunoResearch Cat#706-005-148; RRID: AB_2340443 Donkey anti-Mouse IgG unconjugated (1:100) Jackson ImmunoResearch Cat#715-005-150; RRID: AB_2340758 Donkey anti-Rabbit IgG unconjugated (1:100) Jackson ImmunoResearch Cat#711-005-152; RRID: AB_2340585 Guinea pig polyclonal anit-VGluT2 (1:100) Millipore Sigma AB2251-I; RRID: AB_2665454 Mouse monoclonal anti-Bassoon (1:100) Abcam Ab82958; RRID: AB_1860018 Rabbit polyclonal anti-Homer1 (1:100) Synaptic Systems Cat#160 003; RRID: AB_887730 Chemicals, peptides, and recombinant proteins Alexa Fluor 405 NHS-ester Thermo Fisher Scientific Cat#A30000 Alexa Fluor 647 NHS-ester Thermo Fisher Scientific Cat#A20006 Atto 488 NHS-ester ATTO-TEC GmbH AD 488–31 Catalase from bovine liver Sigma-Aldrich C1345 Chloroform Sigma-Aldrich Cat#288306 Cy-3B Mono NHS-ester Cytiva PA63101 Cysteamine Sigma-Aldrich Cat#30070 DY-749P1 NHS-ester Dyomics GmnH Cat#749P1-01 Dulbecco’s Phosphate Buffered Saline Sigma-Aldrich D8662 Ethanol Pharmco Cat#111000200C1GL FluoSpheres Infrared (715/755) Invitrogen Cat#F8799 FluoSpheres Orange (540/560) Invitrogen Cat#F8809 D-(+)-Glucose Sigma Aldrich Cat#G7528 Glucose Oxidase Sigma-Aldrich G2133 Glutaraldehyde 70%, EM grade Electron Microscopy Sciences Cat#16360 Normal Donkey Serum Jackson ImmunoResearch Cat#017-000-121 Paraformaldehyde 16%, EM grade Electron Microscopy Sciences Cat#15710 Sodium azide Sigma-Aldrich S2002 Sodium chloride Sigma-Aldrich S9888 Sodium hydroxide pellets Sigma-Aldrich Cat#567530 Tris-base (Trizma-base) Sigma-Aldrich T8524 Triton X-100 Sigma-Aldrich Cat#11332481001 Critical commercial assays UltraBed Kit Electron Microscopy Sciences Cat#14310 Experimental models: Organisms/strains Mouse: C57BL/6J Age: 2–8 days; Sex: M/F The Jackson Laboratory Cat#000664 Mouse: b2-nAChR / Age: 2–8 days; Sex: M/F Burbridge et al.104 N/A Oligonucleotides Primer: nAChR forward: CAGGCGTT ATCCACAAAGACAGA Burbridge et al.104 N/A Primer: nAChR reverse: TTGAGGGG AGCAGAACAGAATC Burbridge et al.104 N/A Primer: nAChR mutant reverse: ACTTGGGTTTGGGCGTGTTGAG Burbridge et al.104 N/A (Continued on next page) 14 Cell Reports 42, 112085, February 28, 2023 Article Title: Phosphorylation-dependent membraneless organelle fusion and fission illustrated by postsynaptic density assemblies. Article Snippet: Article Article Title: Presynaptic activity and protein turnover are correlated at the single-synapse level. Article Snippet: REAGENT or Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The blocked membranes from both in vivo and in vitro experiments were probed with following primary antibodies: Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal antiBassoon at 1:1000 ( Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal anti-Bassoon at 1:1000 ( Imaging:Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The dilution ratio of primary antibodies was as follows: Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: After sections were washed with PBS (10 min × 2) and blocking solution (20 min × 1), DyLight405 anti-guinea pig (Jackson ImmunoResearch Laboratories), Alexa Fluor 488 anti-chicken (Jackson ImmunoResearch Laboratories), and Alexa Fluor 594 anti-rabbit (Jackson ImmunoResearch Laboratories) were added to samples at a dilution of 1:800 for secondary antibody incubation at room temperature for 1 h. The immunostained slides were mounted with ProLong Gold antifade reagent (Life Technologies) and cured for 24 h. Fluorescent images of immunostained sections were acquired at 5×, 40×, and 63× magnifications with a Zeiss LSM 880 confocal microscope. Article Title: The synaptic basis of activity-dependent eye-specific competition. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Donkey anti-Guinea pig IgG unconjugated (1:100) Jackson ImmunoResearch Cat#706-005-148; RRID: AB_2340443 Donkey anti-Mouse IgG unconjugated (1:100) Jackson ImmunoResearch Cat#715-005-150; RRID: AB_2340758 Donkey anti-Rabbit IgG unconjugated (1:100) Jackson ImmunoResearch Cat#711-005-152; RRID: AB_2340585 Guinea pig polyclonal anit-VGluT2 (1:100) Millipore Sigma AB2251-I; RRID: AB_2665454 Mouse monoclonal anti-Bassoon (1:100) Abcam Ab82958; RRID: AB_1860018 Rabbit polyclonal anti-Homer1 (1:100) Synaptic Systems Cat#160 003; RRID: AB_887730 Chemicals, peptides, and recombinant proteins Alexa Fluor 405 NHS-ester Thermo Fisher Scientific Cat#A30000 Alexa Fluor 647 NHS-ester Thermo Fisher Scientific Cat#A20006 Atto 488 NHS-ester ATTO-TEC GmbH AD 488–31 Catalase from bovine liver Sigma-Aldrich C1345 Chloroform Sigma-Aldrich Cat#288306 Cy-3B Mono NHS-ester Cytiva PA63101 Cysteamine Sigma-Aldrich Cat#30070 DY-749P1 NHS-ester Dyomics GmnH Cat#749P1-01 Dulbecco’s Phosphate Buffered Saline Sigma-Aldrich D8662 Ethanol Pharmco Cat#111000200C1GL FluoSpheres Infrared (715/755) Invitrogen Cat#F8799 FluoSpheres Orange (540/560) Invitrogen Cat#F8809 D-(+)-Glucose Sigma Aldrich Cat#G7528 Glucose Oxidase Sigma-Aldrich G2133 Glutaraldehyde 70%, EM grade Electron Microscopy Sciences Cat#16360 Normal Donkey Serum Jackson ImmunoResearch Cat#017-000-121 Paraformaldehyde 16%, EM grade Electron Microscopy Sciences Cat#15710 Sodium azide Sigma-Aldrich S2002 Sodium chloride Sigma-Aldrich S9888 Sodium hydroxide pellets Sigma-Aldrich Cat#567530 Tris-base (Trizma-base) Sigma-Aldrich T8524 Triton X-100 Sigma-Aldrich Cat#11332481001 Critical commercial assays UltraBed Kit Electron Microscopy Sciences Cat#14310 Experimental models: Organisms/strains Mouse: C57BL/6J Age: 2–8 days; Sex: M/F The Jackson Laboratory Cat#000664 Mouse: b2-nAChR / Age: 2–8 days; Sex: M/F Burbridge et al.104 N/A Oligonucleotides Primer: nAChR forward: CAGGCGTT ATCCACAAAGACAGA Burbridge et al.104 N/A Primer: nAChR reverse: TTGAGGGG AGCAGAACAGAATC Burbridge et al.104 N/A Primer: nAChR mutant reverse: ACTTGGGTTTGGGCGTGTTGAG Burbridge et al.104 N/A (Continued on next page) 14 Cell Reports 42, 112085, February 28, 2023 Article Title: Phosphorylation-dependent membraneless organelle fusion and fission illustrated by postsynaptic density assemblies. Article Snippet: Article Article Title: Presynaptic activity and protein turnover are correlated at the single-synapse level. Article Snippet: REAGENT or Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The blocked membranes from both in vivo and in vitro experiments were probed with following primary antibodies: Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal antiBassoon at 1:1000 ( Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal anti-Bassoon at 1:1000 ( Microscopy:Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The dilution ratio of primary antibodies was as follows: Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: After sections were washed with PBS (10 min × 2) and blocking solution (20 min × 1), DyLight405 anti-guinea pig (Jackson ImmunoResearch Laboratories), Alexa Fluor 488 anti-chicken (Jackson ImmunoResearch Laboratories), and Alexa Fluor 594 anti-rabbit (Jackson ImmunoResearch Laboratories) were added to samples at a dilution of 1:800 for secondary antibody incubation at room temperature for 1 h. The immunostained slides were mounted with ProLong Gold antifade reagent (Life Technologies) and cured for 24 h. Fluorescent images of immunostained sections were acquired at 5×, 40×, and 63× magnifications with a Zeiss LSM 880 confocal microscope. Article Title: The synaptic basis of activity-dependent eye-specific competition. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Donkey anti-Guinea pig IgG unconjugated (1:100) Jackson ImmunoResearch Cat#706-005-148; RRID: AB_2340443 Donkey anti-Mouse IgG unconjugated (1:100) Jackson ImmunoResearch Cat#715-005-150; RRID: AB_2340758 Donkey anti-Rabbit IgG unconjugated (1:100) Jackson ImmunoResearch Cat#711-005-152; RRID: AB_2340585 Guinea pig polyclonal anit-VGluT2 (1:100) Millipore Sigma AB2251-I; RRID: AB_2665454 Mouse monoclonal anti-Bassoon (1:100) Abcam Ab82958; RRID: AB_1860018 Rabbit polyclonal anti-Homer1 (1:100) Synaptic Systems Cat#160 003; RRID: AB_887730 Chemicals, peptides, and recombinant proteins Alexa Fluor 405 NHS-ester Thermo Fisher Scientific Cat#A30000 Alexa Fluor 647 NHS-ester Thermo Fisher Scientific Cat#A20006 Atto 488 NHS-ester ATTO-TEC GmbH AD 488–31 Catalase from bovine liver Sigma-Aldrich C1345 Chloroform Sigma-Aldrich Cat#288306 Cy-3B Mono NHS-ester Cytiva PA63101 Cysteamine Sigma-Aldrich Cat#30070 DY-749P1 NHS-ester Dyomics GmnH Cat#749P1-01 Dulbecco’s Phosphate Buffered Saline Sigma-Aldrich D8662 Ethanol Pharmco Cat#111000200C1GL FluoSpheres Infrared (715/755) Invitrogen Cat#F8799 FluoSpheres Orange (540/560) Invitrogen Cat#F8809 D-(+)-Glucose Sigma Aldrich Cat#G7528 Glucose Oxidase Sigma-Aldrich G2133 Glutaraldehyde 70%, EM grade Electron Microscopy Sciences Cat#16360 Normal Donkey Serum Jackson ImmunoResearch Cat#017-000-121 Paraformaldehyde 16%, EM grade Electron Microscopy Sciences Cat#15710 Sodium azide Sigma-Aldrich S2002 Sodium chloride Sigma-Aldrich S9888 Sodium hydroxide pellets Sigma-Aldrich Cat#567530 Tris-base (Trizma-base) Sigma-Aldrich T8524 Triton X-100 Sigma-Aldrich Cat#11332481001 Critical commercial assays UltraBed Kit Electron Microscopy Sciences Cat#14310 Experimental models: Organisms/strains Mouse: C57BL/6J Age: 2–8 days; Sex: M/F The Jackson Laboratory Cat#000664 Mouse: b2-nAChR / Age: 2–8 days; Sex: M/F Burbridge et al.104 N/A Oligonucleotides Primer: nAChR forward: CAGGCGTT ATCCACAAAGACAGA Burbridge et al.104 N/A Primer: nAChR reverse: TTGAGGGG AGCAGAACAGAATC Burbridge et al.104 N/A Primer: nAChR mutant reverse: ACTTGGGTTTGGGCGTGTTGAG Burbridge et al.104 N/A (Continued on next page) 14 Cell Reports 42, 112085, February 28, 2023 Article Title: Phosphorylation-dependent membraneless organelle fusion and fission illustrated by postsynaptic density assemblies. Article Snippet: Article Article Title: Presynaptic activity and protein turnover are correlated at the single-synapse level. Article Snippet: REAGENT or Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The blocked membranes from both in vivo and in vitro experiments were probed with following primary antibodies: Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal antiBassoon at 1:1000 ( Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal anti-Bassoon at 1:1000 ( Labeling:Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The dilution ratio of primary antibodies was as follows: Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: After sections were washed with PBS (10 min × 2) and blocking solution (20 min × 1), DyLight405 anti-guinea pig (Jackson ImmunoResearch Laboratories), Alexa Fluor 488 anti-chicken (Jackson ImmunoResearch Laboratories), and Alexa Fluor 594 anti-rabbit (Jackson ImmunoResearch Laboratories) were added to samples at a dilution of 1:800 for secondary antibody incubation at room temperature for 1 h. The immunostained slides were mounted with ProLong Gold antifade reagent (Life Technologies) and cured for 24 h. Fluorescent images of immunostained sections were acquired at 5×, 40×, and 63× magnifications with a Zeiss LSM 880 confocal microscope. Article Title: The synaptic basis of activity-dependent eye-specific competition. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Donkey anti-Guinea pig IgG unconjugated (1:100) Jackson ImmunoResearch Cat#706-005-148; RRID: AB_2340443 Donkey anti-Mouse IgG unconjugated (1:100) Jackson ImmunoResearch Cat#715-005-150; RRID: AB_2340758 Donkey anti-Rabbit IgG unconjugated (1:100) Jackson ImmunoResearch Cat#711-005-152; RRID: AB_2340585 Guinea pig polyclonal anit-VGluT2 (1:100) Millipore Sigma AB2251-I; RRID: AB_2665454 Mouse monoclonal anti-Bassoon (1:100) Abcam Ab82958; RRID: AB_1860018 Rabbit polyclonal anti-Homer1 (1:100) Synaptic Systems Cat#160 003; RRID: AB_887730 Chemicals, peptides, and recombinant proteins Alexa Fluor 405 NHS-ester Thermo Fisher Scientific Cat#A30000 Alexa Fluor 647 NHS-ester Thermo Fisher Scientific Cat#A20006 Atto 488 NHS-ester ATTO-TEC GmbH AD 488–31 Catalase from bovine liver Sigma-Aldrich C1345 Chloroform Sigma-Aldrich Cat#288306 Cy-3B Mono NHS-ester Cytiva PA63101 Cysteamine Sigma-Aldrich Cat#30070 DY-749P1 NHS-ester Dyomics GmnH Cat#749P1-01 Dulbecco’s Phosphate Buffered Saline Sigma-Aldrich D8662 Ethanol Pharmco Cat#111000200C1GL FluoSpheres Infrared (715/755) Invitrogen Cat#F8799 FluoSpheres Orange (540/560) Invitrogen Cat#F8809 D-(+)-Glucose Sigma Aldrich Cat#G7528 Glucose Oxidase Sigma-Aldrich G2133 Glutaraldehyde 70%, EM grade Electron Microscopy Sciences Cat#16360 Normal Donkey Serum Jackson ImmunoResearch Cat#017-000-121 Paraformaldehyde 16%, EM grade Electron Microscopy Sciences Cat#15710 Sodium azide Sigma-Aldrich S2002 Sodium chloride Sigma-Aldrich S9888 Sodium hydroxide pellets Sigma-Aldrich Cat#567530 Tris-base (Trizma-base) Sigma-Aldrich T8524 Triton X-100 Sigma-Aldrich Cat#11332481001 Critical commercial assays UltraBed Kit Electron Microscopy Sciences Cat#14310 Experimental models: Organisms/strains Mouse: C57BL/6J Age: 2–8 days; Sex: M/F The Jackson Laboratory Cat#000664 Mouse: b2-nAChR / Age: 2–8 days; Sex: M/F Burbridge et al.104 N/A Oligonucleotides Primer: nAChR forward: CAGGCGTT ATCCACAAAGACAGA Burbridge et al.104 N/A Primer: nAChR reverse: TTGAGGGG AGCAGAACAGAATC Burbridge et al.104 N/A Primer: nAChR mutant reverse: ACTTGGGTTTGGGCGTGTTGAG Burbridge et al.104 N/A (Continued on next page) 14 Cell Reports 42, 112085, February 28, 2023 Article Title: Phosphorylation-dependent membraneless organelle fusion and fission illustrated by postsynaptic density assemblies. Article Snippet: Article Article Title: Presynaptic activity and protein turnover are correlated at the single-synapse level. Article Snippet: REAGENT or Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The blocked membranes from both in vivo and in vitro experiments were probed with following primary antibodies: Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal antiBassoon at 1:1000 ( Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal anti-Bassoon at 1:1000 ( Over Expression:Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The dilution ratio of primary antibodies was as follows: Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: After sections were washed with PBS (10 min × 2) and blocking solution (20 min × 1), DyLight405 anti-guinea pig (Jackson ImmunoResearch Laboratories), Alexa Fluor 488 anti-chicken (Jackson ImmunoResearch Laboratories), and Alexa Fluor 594 anti-rabbit (Jackson ImmunoResearch Laboratories) were added to samples at a dilution of 1:800 for secondary antibody incubation at room temperature for 1 h. The immunostained slides were mounted with ProLong Gold antifade reagent (Life Technologies) and cured for 24 h. Fluorescent images of immunostained sections were acquired at 5×, 40×, and 63× magnifications with a Zeiss LSM 880 confocal microscope. Article Title: The synaptic basis of activity-dependent eye-specific competition. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Donkey anti-Guinea pig IgG unconjugated (1:100) Jackson ImmunoResearch Cat#706-005-148; RRID: AB_2340443 Donkey anti-Mouse IgG unconjugated (1:100) Jackson ImmunoResearch Cat#715-005-150; RRID: AB_2340758 Donkey anti-Rabbit IgG unconjugated (1:100) Jackson ImmunoResearch Cat#711-005-152; RRID: AB_2340585 Guinea pig polyclonal anit-VGluT2 (1:100) Millipore Sigma AB2251-I; RRID: AB_2665454 Mouse monoclonal anti-Bassoon (1:100) Abcam Ab82958; RRID: AB_1860018 Rabbit polyclonal anti-Homer1 (1:100) Synaptic Systems Cat#160 003; RRID: AB_887730 Chemicals, peptides, and recombinant proteins Alexa Fluor 405 NHS-ester Thermo Fisher Scientific Cat#A30000 Alexa Fluor 647 NHS-ester Thermo Fisher Scientific Cat#A20006 Atto 488 NHS-ester ATTO-TEC GmbH AD 488–31 Catalase from bovine liver Sigma-Aldrich C1345 Chloroform Sigma-Aldrich Cat#288306 Cy-3B Mono NHS-ester Cytiva PA63101 Cysteamine Sigma-Aldrich Cat#30070 DY-749P1 NHS-ester Dyomics GmnH Cat#749P1-01 Dulbecco’s Phosphate Buffered Saline Sigma-Aldrich D8662 Ethanol Pharmco Cat#111000200C1GL FluoSpheres Infrared (715/755) Invitrogen Cat#F8799 FluoSpheres Orange (540/560) Invitrogen Cat#F8809 D-(+)-Glucose Sigma Aldrich Cat#G7528 Glucose Oxidase Sigma-Aldrich G2133 Glutaraldehyde 70%, EM grade Electron Microscopy Sciences Cat#16360 Normal Donkey Serum Jackson ImmunoResearch Cat#017-000-121 Paraformaldehyde 16%, EM grade Electron Microscopy Sciences Cat#15710 Sodium azide Sigma-Aldrich S2002 Sodium chloride Sigma-Aldrich S9888 Sodium hydroxide pellets Sigma-Aldrich Cat#567530 Tris-base (Trizma-base) Sigma-Aldrich T8524 Triton X-100 Sigma-Aldrich Cat#11332481001 Critical commercial assays UltraBed Kit Electron Microscopy Sciences Cat#14310 Experimental models: Organisms/strains Mouse: C57BL/6J Age: 2–8 days; Sex: M/F The Jackson Laboratory Cat#000664 Mouse: b2-nAChR / Age: 2–8 days; Sex: M/F Burbridge et al.104 N/A Oligonucleotides Primer: nAChR forward: CAGGCGTT ATCCACAAAGACAGA Burbridge et al.104 N/A Primer: nAChR reverse: TTGAGGGG AGCAGAACAGAATC Burbridge et al.104 N/A Primer: nAChR mutant reverse: ACTTGGGTTTGGGCGTGTTGAG Burbridge et al.104 N/A (Continued on next page) 14 Cell Reports 42, 112085, February 28, 2023 Article Title: Phosphorylation-dependent membraneless organelle fusion and fission illustrated by postsynaptic density assemblies. Article Snippet: Article Article Title: Presynaptic activity and protein turnover are correlated at the single-synapse level. Article Snippet: REAGENT or Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The blocked membranes from both in vivo and in vitro experiments were probed with following primary antibodies: Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal antiBassoon at 1:1000 ( Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal anti-Bassoon at 1:1000 ( Infection:Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The dilution ratio of primary antibodies was as follows: Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: After sections were washed with PBS (10 min × 2) and blocking solution (20 min × 1), DyLight405 anti-guinea pig (Jackson ImmunoResearch Laboratories), Alexa Fluor 488 anti-chicken (Jackson ImmunoResearch Laboratories), and Alexa Fluor 594 anti-rabbit (Jackson ImmunoResearch Laboratories) were added to samples at a dilution of 1:800 for secondary antibody incubation at room temperature for 1 h. The immunostained slides were mounted with ProLong Gold antifade reagent (Life Technologies) and cured for 24 h. Fluorescent images of immunostained sections were acquired at 5×, 40×, and 63× magnifications with a Zeiss LSM 880 confocal microscope. Article Title: The synaptic basis of activity-dependent eye-specific competition. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Donkey anti-Guinea pig IgG unconjugated (1:100) Jackson ImmunoResearch Cat#706-005-148; RRID: AB_2340443 Donkey anti-Mouse IgG unconjugated (1:100) Jackson ImmunoResearch Cat#715-005-150; RRID: AB_2340758 Donkey anti-Rabbit IgG unconjugated (1:100) Jackson ImmunoResearch Cat#711-005-152; RRID: AB_2340585 Guinea pig polyclonal anit-VGluT2 (1:100) Millipore Sigma AB2251-I; RRID: AB_2665454 Mouse monoclonal anti-Bassoon (1:100) Abcam Ab82958; RRID: AB_1860018 Rabbit polyclonal anti-Homer1 (1:100) Synaptic Systems Cat#160 003; RRID: AB_887730 Chemicals, peptides, and recombinant proteins Alexa Fluor 405 NHS-ester Thermo Fisher Scientific Cat#A30000 Alexa Fluor 647 NHS-ester Thermo Fisher Scientific Cat#A20006 Atto 488 NHS-ester ATTO-TEC GmbH AD 488–31 Catalase from bovine liver Sigma-Aldrich C1345 Chloroform Sigma-Aldrich Cat#288306 Cy-3B Mono NHS-ester Cytiva PA63101 Cysteamine Sigma-Aldrich Cat#30070 DY-749P1 NHS-ester Dyomics GmnH Cat#749P1-01 Dulbecco’s Phosphate Buffered Saline Sigma-Aldrich D8662 Ethanol Pharmco Cat#111000200C1GL FluoSpheres Infrared (715/755) Invitrogen Cat#F8799 FluoSpheres Orange (540/560) Invitrogen Cat#F8809 D-(+)-Glucose Sigma Aldrich Cat#G7528 Glucose Oxidase Sigma-Aldrich G2133 Glutaraldehyde 70%, EM grade Electron Microscopy Sciences Cat#16360 Normal Donkey Serum Jackson ImmunoResearch Cat#017-000-121 Paraformaldehyde 16%, EM grade Electron Microscopy Sciences Cat#15710 Sodium azide Sigma-Aldrich S2002 Sodium chloride Sigma-Aldrich S9888 Sodium hydroxide pellets Sigma-Aldrich Cat#567530 Tris-base (Trizma-base) Sigma-Aldrich T8524 Triton X-100 Sigma-Aldrich Cat#11332481001 Critical commercial assays UltraBed Kit Electron Microscopy Sciences Cat#14310 Experimental models: Organisms/strains Mouse: C57BL/6J Age: 2–8 days; Sex: M/F The Jackson Laboratory Cat#000664 Mouse: b2-nAChR / Age: 2–8 days; Sex: M/F Burbridge et al.104 N/A Oligonucleotides Primer: nAChR forward: CAGGCGTT ATCCACAAAGACAGA Burbridge et al.104 N/A Primer: nAChR reverse: TTGAGGGG AGCAGAACAGAATC Burbridge et al.104 N/A Primer: nAChR mutant reverse: ACTTGGGTTTGGGCGTGTTGAG Burbridge et al.104 N/A (Continued on next page) 14 Cell Reports 42, 112085, February 28, 2023 Article Title: Phosphorylation-dependent membraneless organelle fusion and fission illustrated by postsynaptic density assemblies. Article Snippet: Article Article Title: Presynaptic activity and protein turnover are correlated at the single-synapse level. Article Snippet: REAGENT or Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The blocked membranes from both in vivo and in vitro experiments were probed with following primary antibodies: Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal antiBassoon at 1:1000 ( Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal anti-Bassoon at 1:1000 ( Immunolabeling:Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The dilution ratio of primary antibodies was as follows: Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: After sections were washed with PBS (10 min × 2) and blocking solution (20 min × 1), DyLight405 anti-guinea pig (Jackson ImmunoResearch Laboratories), Alexa Fluor 488 anti-chicken (Jackson ImmunoResearch Laboratories), and Alexa Fluor 594 anti-rabbit (Jackson ImmunoResearch Laboratories) were added to samples at a dilution of 1:800 for secondary antibody incubation at room temperature for 1 h. The immunostained slides were mounted with ProLong Gold antifade reagent (Life Technologies) and cured for 24 h. Fluorescent images of immunostained sections were acquired at 5×, 40×, and 63× magnifications with a Zeiss LSM 880 confocal microscope. Article Title: The synaptic basis of activity-dependent eye-specific competition. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Donkey anti-Guinea pig IgG unconjugated (1:100) Jackson ImmunoResearch Cat#706-005-148; RRID: AB_2340443 Donkey anti-Mouse IgG unconjugated (1:100) Jackson ImmunoResearch Cat#715-005-150; RRID: AB_2340758 Donkey anti-Rabbit IgG unconjugated (1:100) Jackson ImmunoResearch Cat#711-005-152; RRID: AB_2340585 Guinea pig polyclonal anit-VGluT2 (1:100) Millipore Sigma AB2251-I; RRID: AB_2665454 Mouse monoclonal anti-Bassoon (1:100) Abcam Ab82958; RRID: AB_1860018 Rabbit polyclonal anti-Homer1 (1:100) Synaptic Systems Cat#160 003; RRID: AB_887730 Chemicals, peptides, and recombinant proteins Alexa Fluor 405 NHS-ester Thermo Fisher Scientific Cat#A30000 Alexa Fluor 647 NHS-ester Thermo Fisher Scientific Cat#A20006 Atto 488 NHS-ester ATTO-TEC GmbH AD 488–31 Catalase from bovine liver Sigma-Aldrich C1345 Chloroform Sigma-Aldrich Cat#288306 Cy-3B Mono NHS-ester Cytiva PA63101 Cysteamine Sigma-Aldrich Cat#30070 DY-749P1 NHS-ester Dyomics GmnH Cat#749P1-01 Dulbecco’s Phosphate Buffered Saline Sigma-Aldrich D8662 Ethanol Pharmco Cat#111000200C1GL FluoSpheres Infrared (715/755) Invitrogen Cat#F8799 FluoSpheres Orange (540/560) Invitrogen Cat#F8809 D-(+)-Glucose Sigma Aldrich Cat#G7528 Glucose Oxidase Sigma-Aldrich G2133 Glutaraldehyde 70%, EM grade Electron Microscopy Sciences Cat#16360 Normal Donkey Serum Jackson ImmunoResearch Cat#017-000-121 Paraformaldehyde 16%, EM grade Electron Microscopy Sciences Cat#15710 Sodium azide Sigma-Aldrich S2002 Sodium chloride Sigma-Aldrich S9888 Sodium hydroxide pellets Sigma-Aldrich Cat#567530 Tris-base (Trizma-base) Sigma-Aldrich T8524 Triton X-100 Sigma-Aldrich Cat#11332481001 Critical commercial assays UltraBed Kit Electron Microscopy Sciences Cat#14310 Experimental models: Organisms/strains Mouse: C57BL/6J Age: 2–8 days; Sex: M/F The Jackson Laboratory Cat#000664 Mouse: b2-nAChR / Age: 2–8 days; Sex: M/F Burbridge et al.104 N/A Oligonucleotides Primer: nAChR forward: CAGGCGTT ATCCACAAAGACAGA Burbridge et al.104 N/A Primer: nAChR reverse: TTGAGGGG AGCAGAACAGAATC Burbridge et al.104 N/A Primer: nAChR mutant reverse: ACTTGGGTTTGGGCGTGTTGAG Burbridge et al.104 N/A (Continued on next page) 14 Cell Reports 42, 112085, February 28, 2023 Article Title: Phosphorylation-dependent membraneless organelle fusion and fission illustrated by postsynaptic density assemblies. Article Snippet: Article Article Title: Presynaptic activity and protein turnover are correlated at the single-synapse level. Article Snippet: REAGENT or Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The blocked membranes from both in vivo and in vitro experiments were probed with following primary antibodies: Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal antiBassoon at 1:1000 ( Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal anti-Bassoon at 1:1000 ( Staining:Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The dilution ratio of primary antibodies was as follows: Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: After sections were washed with PBS (10 min × 2) and blocking solution (20 min × 1), DyLight405 anti-guinea pig (Jackson ImmunoResearch Laboratories), Alexa Fluor 488 anti-chicken (Jackson ImmunoResearch Laboratories), and Alexa Fluor 594 anti-rabbit (Jackson ImmunoResearch Laboratories) were added to samples at a dilution of 1:800 for secondary antibody incubation at room temperature for 1 h. The immunostained slides were mounted with ProLong Gold antifade reagent (Life Technologies) and cured for 24 h. Fluorescent images of immunostained sections were acquired at 5×, 40×, and 63× magnifications with a Zeiss LSM 880 confocal microscope. Article Title: The synaptic basis of activity-dependent eye-specific competition. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Donkey anti-Guinea pig IgG unconjugated (1:100) Jackson ImmunoResearch Cat#706-005-148; RRID: AB_2340443 Donkey anti-Mouse IgG unconjugated (1:100) Jackson ImmunoResearch Cat#715-005-150; RRID: AB_2340758 Donkey anti-Rabbit IgG unconjugated (1:100) Jackson ImmunoResearch Cat#711-005-152; RRID: AB_2340585 Guinea pig polyclonal anit-VGluT2 (1:100) Millipore Sigma AB2251-I; RRID: AB_2665454 Mouse monoclonal anti-Bassoon (1:100) Abcam Ab82958; RRID: AB_1860018 Rabbit polyclonal anti-Homer1 (1:100) Synaptic Systems Cat#160 003; RRID: AB_887730 Chemicals, peptides, and recombinant proteins Alexa Fluor 405 NHS-ester Thermo Fisher Scientific Cat#A30000 Alexa Fluor 647 NHS-ester Thermo Fisher Scientific Cat#A20006 Atto 488 NHS-ester ATTO-TEC GmbH AD 488–31 Catalase from bovine liver Sigma-Aldrich C1345 Chloroform Sigma-Aldrich Cat#288306 Cy-3B Mono NHS-ester Cytiva PA63101 Cysteamine Sigma-Aldrich Cat#30070 DY-749P1 NHS-ester Dyomics GmnH Cat#749P1-01 Dulbecco’s Phosphate Buffered Saline Sigma-Aldrich D8662 Ethanol Pharmco Cat#111000200C1GL FluoSpheres Infrared (715/755) Invitrogen Cat#F8799 FluoSpheres Orange (540/560) Invitrogen Cat#F8809 D-(+)-Glucose Sigma Aldrich Cat#G7528 Glucose Oxidase Sigma-Aldrich G2133 Glutaraldehyde 70%, EM grade Electron Microscopy Sciences Cat#16360 Normal Donkey Serum Jackson ImmunoResearch Cat#017-000-121 Paraformaldehyde 16%, EM grade Electron Microscopy Sciences Cat#15710 Sodium azide Sigma-Aldrich S2002 Sodium chloride Sigma-Aldrich S9888 Sodium hydroxide pellets Sigma-Aldrich Cat#567530 Tris-base (Trizma-base) Sigma-Aldrich T8524 Triton X-100 Sigma-Aldrich Cat#11332481001 Critical commercial assays UltraBed Kit Electron Microscopy Sciences Cat#14310 Experimental models: Organisms/strains Mouse: C57BL/6J Age: 2–8 days; Sex: M/F The Jackson Laboratory Cat#000664 Mouse: b2-nAChR / Age: 2–8 days; Sex: M/F Burbridge et al.104 N/A Oligonucleotides Primer: nAChR forward: CAGGCGTT ATCCACAAAGACAGA Burbridge et al.104 N/A Primer: nAChR reverse: TTGAGGGG AGCAGAACAGAATC Burbridge et al.104 N/A Primer: nAChR mutant reverse: ACTTGGGTTTGGGCGTGTTGAG Burbridge et al.104 N/A (Continued on next page) 14 Cell Reports 42, 112085, February 28, 2023 Article Title: Phosphorylation-dependent membraneless organelle fusion and fission illustrated by postsynaptic density assemblies. Article Snippet: Article Article Title: Presynaptic activity and protein turnover are correlated at the single-synapse level. Article Snippet: REAGENT or Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The blocked membranes from both in vivo and in vitro experiments were probed with following primary antibodies: Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal antiBassoon at 1:1000 ( Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal anti-Bassoon at 1:1000 ( In Vitro:Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The dilution ratio of primary antibodies was as follows: Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: After sections were washed with PBS (10 min × 2) and blocking solution (20 min × 1), DyLight405 anti-guinea pig (Jackson ImmunoResearch Laboratories), Alexa Fluor 488 anti-chicken (Jackson ImmunoResearch Laboratories), and Alexa Fluor 594 anti-rabbit (Jackson ImmunoResearch Laboratories) were added to samples at a dilution of 1:800 for secondary antibody incubation at room temperature for 1 h. The immunostained slides were mounted with ProLong Gold antifade reagent (Life Technologies) and cured for 24 h. Fluorescent images of immunostained sections were acquired at 5×, 40×, and 63× magnifications with a Zeiss LSM 880 confocal microscope. Article Title: The synaptic basis of activity-dependent eye-specific competition. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Donkey anti-Guinea pig IgG unconjugated (1:100) Jackson ImmunoResearch Cat#706-005-148; RRID: AB_2340443 Donkey anti-Mouse IgG unconjugated (1:100) Jackson ImmunoResearch Cat#715-005-150; RRID: AB_2340758 Donkey anti-Rabbit IgG unconjugated (1:100) Jackson ImmunoResearch Cat#711-005-152; RRID: AB_2340585 Guinea pig polyclonal anit-VGluT2 (1:100) Millipore Sigma AB2251-I; RRID: AB_2665454 Mouse monoclonal anti-Bassoon (1:100) Abcam Ab82958; RRID: AB_1860018 Rabbit polyclonal anti-Homer1 (1:100) Synaptic Systems Cat#160 003; RRID: AB_887730 Chemicals, peptides, and recombinant proteins Alexa Fluor 405 NHS-ester Thermo Fisher Scientific Cat#A30000 Alexa Fluor 647 NHS-ester Thermo Fisher Scientific Cat#A20006 Atto 488 NHS-ester ATTO-TEC GmbH AD 488–31 Catalase from bovine liver Sigma-Aldrich C1345 Chloroform Sigma-Aldrich Cat#288306 Cy-3B Mono NHS-ester Cytiva PA63101 Cysteamine Sigma-Aldrich Cat#30070 DY-749P1 NHS-ester Dyomics GmnH Cat#749P1-01 Dulbecco’s Phosphate Buffered Saline Sigma-Aldrich D8662 Ethanol Pharmco Cat#111000200C1GL FluoSpheres Infrared (715/755) Invitrogen Cat#F8799 FluoSpheres Orange (540/560) Invitrogen Cat#F8809 D-(+)-Glucose Sigma Aldrich Cat#G7528 Glucose Oxidase Sigma-Aldrich G2133 Glutaraldehyde 70%, EM grade Electron Microscopy Sciences Cat#16360 Normal Donkey Serum Jackson ImmunoResearch Cat#017-000-121 Paraformaldehyde 16%, EM grade Electron Microscopy Sciences Cat#15710 Sodium azide Sigma-Aldrich S2002 Sodium chloride Sigma-Aldrich S9888 Sodium hydroxide pellets Sigma-Aldrich Cat#567530 Tris-base (Trizma-base) Sigma-Aldrich T8524 Triton X-100 Sigma-Aldrich Cat#11332481001 Critical commercial assays UltraBed Kit Electron Microscopy Sciences Cat#14310 Experimental models: Organisms/strains Mouse: C57BL/6J Age: 2–8 days; Sex: M/F The Jackson Laboratory Cat#000664 Mouse: b2-nAChR / Age: 2–8 days; Sex: M/F Burbridge et al.104 N/A Oligonucleotides Primer: nAChR forward: CAGGCGTT ATCCACAAAGACAGA Burbridge et al.104 N/A Primer: nAChR reverse: TTGAGGGG AGCAGAACAGAATC Burbridge et al.104 N/A Primer: nAChR mutant reverse: ACTTGGGTTTGGGCGTGTTGAG Burbridge et al.104 N/A (Continued on next page) 14 Cell Reports 42, 112085, February 28, 2023 Article Title: Phosphorylation-dependent membraneless organelle fusion and fission illustrated by postsynaptic density assemblies. Article Snippet: Article Article Title: Presynaptic activity and protein turnover are correlated at the single-synapse level. Article Snippet: REAGENT or Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The blocked membranes from both in vivo and in vitro experiments were probed with following primary antibodies: Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal antiBassoon at 1:1000 ( Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal anti-Bassoon at 1:1000 ( Transfection:Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The dilution ratio of primary antibodies was as follows: Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: After sections were washed with PBS (10 min × 2) and blocking solution (20 min × 1), DyLight405 anti-guinea pig (Jackson ImmunoResearch Laboratories), Alexa Fluor 488 anti-chicken (Jackson ImmunoResearch Laboratories), and Alexa Fluor 594 anti-rabbit (Jackson ImmunoResearch Laboratories) were added to samples at a dilution of 1:800 for secondary antibody incubation at room temperature for 1 h. The immunostained slides were mounted with ProLong Gold antifade reagent (Life Technologies) and cured for 24 h. Fluorescent images of immunostained sections were acquired at 5×, 40×, and 63× magnifications with a Zeiss LSM 880 confocal microscope. Article Title: The synaptic basis of activity-dependent eye-specific competition. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Donkey anti-Guinea pig IgG unconjugated (1:100) Jackson ImmunoResearch Cat#706-005-148; RRID: AB_2340443 Donkey anti-Mouse IgG unconjugated (1:100) Jackson ImmunoResearch Cat#715-005-150; RRID: AB_2340758 Donkey anti-Rabbit IgG unconjugated (1:100) Jackson ImmunoResearch Cat#711-005-152; RRID: AB_2340585 Guinea pig polyclonal anit-VGluT2 (1:100) Millipore Sigma AB2251-I; RRID: AB_2665454 Mouse monoclonal anti-Bassoon (1:100) Abcam Ab82958; RRID: AB_1860018 Rabbit polyclonal anti-Homer1 (1:100) Synaptic Systems Cat#160 003; RRID: AB_887730 Chemicals, peptides, and recombinant proteins Alexa Fluor 405 NHS-ester Thermo Fisher Scientific Cat#A30000 Alexa Fluor 647 NHS-ester Thermo Fisher Scientific Cat#A20006 Atto 488 NHS-ester ATTO-TEC GmbH AD 488–31 Catalase from bovine liver Sigma-Aldrich C1345 Chloroform Sigma-Aldrich Cat#288306 Cy-3B Mono NHS-ester Cytiva PA63101 Cysteamine Sigma-Aldrich Cat#30070 DY-749P1 NHS-ester Dyomics GmnH Cat#749P1-01 Dulbecco’s Phosphate Buffered Saline Sigma-Aldrich D8662 Ethanol Pharmco Cat#111000200C1GL FluoSpheres Infrared (715/755) Invitrogen Cat#F8799 FluoSpheres Orange (540/560) Invitrogen Cat#F8809 D-(+)-Glucose Sigma Aldrich Cat#G7528 Glucose Oxidase Sigma-Aldrich G2133 Glutaraldehyde 70%, EM grade Electron Microscopy Sciences Cat#16360 Normal Donkey Serum Jackson ImmunoResearch Cat#017-000-121 Paraformaldehyde 16%, EM grade Electron Microscopy Sciences Cat#15710 Sodium azide Sigma-Aldrich S2002 Sodium chloride Sigma-Aldrich S9888 Sodium hydroxide pellets Sigma-Aldrich Cat#567530 Tris-base (Trizma-base) Sigma-Aldrich T8524 Triton X-100 Sigma-Aldrich Cat#11332481001 Critical commercial assays UltraBed Kit Electron Microscopy Sciences Cat#14310 Experimental models: Organisms/strains Mouse: C57BL/6J Age: 2–8 days; Sex: M/F The Jackson Laboratory Cat#000664 Mouse: b2-nAChR / Age: 2–8 days; Sex: M/F Burbridge et al.104 N/A Oligonucleotides Primer: nAChR forward: CAGGCGTT ATCCACAAAGACAGA Burbridge et al.104 N/A Primer: nAChR reverse: TTGAGGGG AGCAGAACAGAATC Burbridge et al.104 N/A Primer: nAChR mutant reverse: ACTTGGGTTTGGGCGTGTTGAG Burbridge et al.104 N/A (Continued on next page) 14 Cell Reports 42, 112085, February 28, 2023 Article Title: Phosphorylation-dependent membraneless organelle fusion and fission illustrated by postsynaptic density assemblies. Article Snippet: Article Article Title: Presynaptic activity and protein turnover are correlated at the single-synapse level. Article Snippet: REAGENT or Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The blocked membranes from both in vivo and in vitro experiments were probed with following primary antibodies: Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal antiBassoon at 1:1000 ( Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal anti-Bassoon at 1:1000 ( Fluorescence:Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The dilution ratio of primary antibodies was as follows: Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: After sections were washed with PBS (10 min × 2) and blocking solution (20 min × 1), DyLight405 anti-guinea pig (Jackson ImmunoResearch Laboratories), Alexa Fluor 488 anti-chicken (Jackson ImmunoResearch Laboratories), and Alexa Fluor 594 anti-rabbit (Jackson ImmunoResearch Laboratories) were added to samples at a dilution of 1:800 for secondary antibody incubation at room temperature for 1 h. The immunostained slides were mounted with ProLong Gold antifade reagent (Life Technologies) and cured for 24 h. Fluorescent images of immunostained sections were acquired at 5×, 40×, and 63× magnifications with a Zeiss LSM 880 confocal microscope. Article Title: The synaptic basis of activity-dependent eye-specific competition. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Donkey anti-Guinea pig IgG unconjugated (1:100) Jackson ImmunoResearch Cat#706-005-148; RRID: AB_2340443 Donkey anti-Mouse IgG unconjugated (1:100) Jackson ImmunoResearch Cat#715-005-150; RRID: AB_2340758 Donkey anti-Rabbit IgG unconjugated (1:100) Jackson ImmunoResearch Cat#711-005-152; RRID: AB_2340585 Guinea pig polyclonal anit-VGluT2 (1:100) Millipore Sigma AB2251-I; RRID: AB_2665454 Mouse monoclonal anti-Bassoon (1:100) Abcam Ab82958; RRID: AB_1860018 Rabbit polyclonal anti-Homer1 (1:100) Synaptic Systems Cat#160 003; RRID: AB_887730 Chemicals, peptides, and recombinant proteins Alexa Fluor 405 NHS-ester Thermo Fisher Scientific Cat#A30000 Alexa Fluor 647 NHS-ester Thermo Fisher Scientific Cat#A20006 Atto 488 NHS-ester ATTO-TEC GmbH AD 488–31 Catalase from bovine liver Sigma-Aldrich C1345 Chloroform Sigma-Aldrich Cat#288306 Cy-3B Mono NHS-ester Cytiva PA63101 Cysteamine Sigma-Aldrich Cat#30070 DY-749P1 NHS-ester Dyomics GmnH Cat#749P1-01 Dulbecco’s Phosphate Buffered Saline Sigma-Aldrich D8662 Ethanol Pharmco Cat#111000200C1GL FluoSpheres Infrared (715/755) Invitrogen Cat#F8799 FluoSpheres Orange (540/560) Invitrogen Cat#F8809 D-(+)-Glucose Sigma Aldrich Cat#G7528 Glucose Oxidase Sigma-Aldrich G2133 Glutaraldehyde 70%, EM grade Electron Microscopy Sciences Cat#16360 Normal Donkey Serum Jackson ImmunoResearch Cat#017-000-121 Paraformaldehyde 16%, EM grade Electron Microscopy Sciences Cat#15710 Sodium azide Sigma-Aldrich S2002 Sodium chloride Sigma-Aldrich S9888 Sodium hydroxide pellets Sigma-Aldrich Cat#567530 Tris-base (Trizma-base) Sigma-Aldrich T8524 Triton X-100 Sigma-Aldrich Cat#11332481001 Critical commercial assays UltraBed Kit Electron Microscopy Sciences Cat#14310 Experimental models: Organisms/strains Mouse: C57BL/6J Age: 2–8 days; Sex: M/F The Jackson Laboratory Cat#000664 Mouse: b2-nAChR / Age: 2–8 days; Sex: M/F Burbridge et al.104 N/A Oligonucleotides Primer: nAChR forward: CAGGCGTT ATCCACAAAGACAGA Burbridge et al.104 N/A Primer: nAChR reverse: TTGAGGGG AGCAGAACAGAATC Burbridge et al.104 N/A Primer: nAChR mutant reverse: ACTTGGGTTTGGGCGTGTTGAG Burbridge et al.104 N/A (Continued on next page) 14 Cell Reports 42, 112085, February 28, 2023 Article Title: Phosphorylation-dependent membraneless organelle fusion and fission illustrated by postsynaptic density assemblies. Article Snippet: Article Article Title: Presynaptic activity and protein turnover are correlated at the single-synapse level. Article Snippet: REAGENT or Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The blocked membranes from both in vivo and in vitro experiments were probed with following primary antibodies: Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal antiBassoon at 1:1000 ( Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal anti-Bassoon at 1:1000 ( In Vivo:Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The dilution ratio of primary antibodies was as follows: Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: After sections were washed with PBS (10 min × 2) and blocking solution (20 min × 1), DyLight405 anti-guinea pig (Jackson ImmunoResearch Laboratories), Alexa Fluor 488 anti-chicken (Jackson ImmunoResearch Laboratories), and Alexa Fluor 594 anti-rabbit (Jackson ImmunoResearch Laboratories) were added to samples at a dilution of 1:800 for secondary antibody incubation at room temperature for 1 h. The immunostained slides were mounted with ProLong Gold antifade reagent (Life Technologies) and cured for 24 h. Fluorescent images of immunostained sections were acquired at 5×, 40×, and 63× magnifications with a Zeiss LSM 880 confocal microscope. Article Title: The synaptic basis of activity-dependent eye-specific competition. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Donkey anti-Guinea pig IgG unconjugated (1:100) Jackson ImmunoResearch Cat#706-005-148; RRID: AB_2340443 Donkey anti-Mouse IgG unconjugated (1:100) Jackson ImmunoResearch Cat#715-005-150; RRID: AB_2340758 Donkey anti-Rabbit IgG unconjugated (1:100) Jackson ImmunoResearch Cat#711-005-152; RRID: AB_2340585 Guinea pig polyclonal anit-VGluT2 (1:100) Millipore Sigma AB2251-I; RRID: AB_2665454 Mouse monoclonal anti-Bassoon (1:100) Abcam Ab82958; RRID: AB_1860018 Rabbit polyclonal anti-Homer1 (1:100) Synaptic Systems Cat#160 003; RRID: AB_887730 Chemicals, peptides, and recombinant proteins Alexa Fluor 405 NHS-ester Thermo Fisher Scientific Cat#A30000 Alexa Fluor 647 NHS-ester Thermo Fisher Scientific Cat#A20006 Atto 488 NHS-ester ATTO-TEC GmbH AD 488–31 Catalase from bovine liver Sigma-Aldrich C1345 Chloroform Sigma-Aldrich Cat#288306 Cy-3B Mono NHS-ester Cytiva PA63101 Cysteamine Sigma-Aldrich Cat#30070 DY-749P1 NHS-ester Dyomics GmnH Cat#749P1-01 Dulbecco’s Phosphate Buffered Saline Sigma-Aldrich D8662 Ethanol Pharmco Cat#111000200C1GL FluoSpheres Infrared (715/755) Invitrogen Cat#F8799 FluoSpheres Orange (540/560) Invitrogen Cat#F8809 D-(+)-Glucose Sigma Aldrich Cat#G7528 Glucose Oxidase Sigma-Aldrich G2133 Glutaraldehyde 70%, EM grade Electron Microscopy Sciences Cat#16360 Normal Donkey Serum Jackson ImmunoResearch Cat#017-000-121 Paraformaldehyde 16%, EM grade Electron Microscopy Sciences Cat#15710 Sodium azide Sigma-Aldrich S2002 Sodium chloride Sigma-Aldrich S9888 Sodium hydroxide pellets Sigma-Aldrich Cat#567530 Tris-base (Trizma-base) Sigma-Aldrich T8524 Triton X-100 Sigma-Aldrich Cat#11332481001 Critical commercial assays UltraBed Kit Electron Microscopy Sciences Cat#14310 Experimental models: Organisms/strains Mouse: C57BL/6J Age: 2–8 days; Sex: M/F The Jackson Laboratory Cat#000664 Mouse: b2-nAChR / Age: 2–8 days; Sex: M/F Burbridge et al.104 N/A Oligonucleotides Primer: nAChR forward: CAGGCGTT ATCCACAAAGACAGA Burbridge et al.104 N/A Primer: nAChR reverse: TTGAGGGG AGCAGAACAGAATC Burbridge et al.104 N/A Primer: nAChR mutant reverse: ACTTGGGTTTGGGCGTGTTGAG Burbridge et al.104 N/A (Continued on next page) 14 Cell Reports 42, 112085, February 28, 2023 Article Title: Phosphorylation-dependent membraneless organelle fusion and fission illustrated by postsynaptic density assemblies. Article Snippet: Article Article Title: Presynaptic activity and protein turnover are correlated at the single-synapse level. Article Snippet: REAGENT or Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The blocked membranes from both in vivo and in vitro experiments were probed with following primary antibodies: Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal antiBassoon at 1:1000 ( Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal anti-Bassoon at 1:1000 ( Injection:Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The dilution ratio of primary antibodies was as follows: Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: After sections were washed with PBS (10 min × 2) and blocking solution (20 min × 1), DyLight405 anti-guinea pig (Jackson ImmunoResearch Laboratories), Alexa Fluor 488 anti-chicken (Jackson ImmunoResearch Laboratories), and Alexa Fluor 594 anti-rabbit (Jackson ImmunoResearch Laboratories) were added to samples at a dilution of 1:800 for secondary antibody incubation at room temperature for 1 h. The immunostained slides were mounted with ProLong Gold antifade reagent (Life Technologies) and cured for 24 h. Fluorescent images of immunostained sections were acquired at 5×, 40×, and 63× magnifications with a Zeiss LSM 880 confocal microscope. Article Title: The synaptic basis of activity-dependent eye-specific competition. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Donkey anti-Guinea pig IgG unconjugated (1:100) Jackson ImmunoResearch Cat#706-005-148; RRID: AB_2340443 Donkey anti-Mouse IgG unconjugated (1:100) Jackson ImmunoResearch Cat#715-005-150; RRID: AB_2340758 Donkey anti-Rabbit IgG unconjugated (1:100) Jackson ImmunoResearch Cat#711-005-152; RRID: AB_2340585 Guinea pig polyclonal anit-VGluT2 (1:100) Millipore Sigma AB2251-I; RRID: AB_2665454 Mouse monoclonal anti-Bassoon (1:100) Abcam Ab82958; RRID: AB_1860018 Rabbit polyclonal anti-Homer1 (1:100) Synaptic Systems Cat#160 003; RRID: AB_887730 Chemicals, peptides, and recombinant proteins Alexa Fluor 405 NHS-ester Thermo Fisher Scientific Cat#A30000 Alexa Fluor 647 NHS-ester Thermo Fisher Scientific Cat#A20006 Atto 488 NHS-ester ATTO-TEC GmbH AD 488–31 Catalase from bovine liver Sigma-Aldrich C1345 Chloroform Sigma-Aldrich Cat#288306 Cy-3B Mono NHS-ester Cytiva PA63101 Cysteamine Sigma-Aldrich Cat#30070 DY-749P1 NHS-ester Dyomics GmnH Cat#749P1-01 Dulbecco’s Phosphate Buffered Saline Sigma-Aldrich D8662 Ethanol Pharmco Cat#111000200C1GL FluoSpheres Infrared (715/755) Invitrogen Cat#F8799 FluoSpheres Orange (540/560) Invitrogen Cat#F8809 D-(+)-Glucose Sigma Aldrich Cat#G7528 Glucose Oxidase Sigma-Aldrich G2133 Glutaraldehyde 70%, EM grade Electron Microscopy Sciences Cat#16360 Normal Donkey Serum Jackson ImmunoResearch Cat#017-000-121 Paraformaldehyde 16%, EM grade Electron Microscopy Sciences Cat#15710 Sodium azide Sigma-Aldrich S2002 Sodium chloride Sigma-Aldrich S9888 Sodium hydroxide pellets Sigma-Aldrich Cat#567530 Tris-base (Trizma-base) Sigma-Aldrich T8524 Triton X-100 Sigma-Aldrich Cat#11332481001 Critical commercial assays UltraBed Kit Electron Microscopy Sciences Cat#14310 Experimental models: Organisms/strains Mouse: C57BL/6J Age: 2–8 days; Sex: M/F The Jackson Laboratory Cat#000664 Mouse: b2-nAChR / Age: 2–8 days; Sex: M/F Burbridge et al.104 N/A Oligonucleotides Primer: nAChR forward: CAGGCGTT ATCCACAAAGACAGA Burbridge et al.104 N/A Primer: nAChR reverse: TTGAGGGG AGCAGAACAGAATC Burbridge et al.104 N/A Primer: nAChR mutant reverse: ACTTGGGTTTGGGCGTGTTGAG Burbridge et al.104 N/A (Continued on next page) 14 Cell Reports 42, 112085, February 28, 2023 Article Title: Phosphorylation-dependent membraneless organelle fusion and fission illustrated by postsynaptic density assemblies. Article Snippet: Article Article Title: Presynaptic activity and protein turnover are correlated at the single-synapse level. Article Snippet: REAGENT or Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The blocked membranes from both in vivo and in vitro experiments were probed with following primary antibodies: Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal antiBassoon at 1:1000 ( Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal anti-Bassoon at 1:1000 ( Western Blot:Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The dilution ratio of primary antibodies was as follows: Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: After sections were washed with PBS (10 min × 2) and blocking solution (20 min × 1), DyLight405 anti-guinea pig (Jackson ImmunoResearch Laboratories), Alexa Fluor 488 anti-chicken (Jackson ImmunoResearch Laboratories), and Alexa Fluor 594 anti-rabbit (Jackson ImmunoResearch Laboratories) were added to samples at a dilution of 1:800 for secondary antibody incubation at room temperature for 1 h. The immunostained slides were mounted with ProLong Gold antifade reagent (Life Technologies) and cured for 24 h. Fluorescent images of immunostained sections were acquired at 5×, 40×, and 63× magnifications with a Zeiss LSM 880 confocal microscope. Article Title: The synaptic basis of activity-dependent eye-specific competition. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Donkey anti-Guinea pig IgG unconjugated (1:100) Jackson ImmunoResearch Cat#706-005-148; RRID: AB_2340443 Donkey anti-Mouse IgG unconjugated (1:100) Jackson ImmunoResearch Cat#715-005-150; RRID: AB_2340758 Donkey anti-Rabbit IgG unconjugated (1:100) Jackson ImmunoResearch Cat#711-005-152; RRID: AB_2340585 Guinea pig polyclonal anit-VGluT2 (1:100) Millipore Sigma AB2251-I; RRID: AB_2665454 Mouse monoclonal anti-Bassoon (1:100) Abcam Ab82958; RRID: AB_1860018 Rabbit polyclonal anti-Homer1 (1:100) Synaptic Systems Cat#160 003; RRID: AB_887730 Chemicals, peptides, and recombinant proteins Alexa Fluor 405 NHS-ester Thermo Fisher Scientific Cat#A30000 Alexa Fluor 647 NHS-ester Thermo Fisher Scientific Cat#A20006 Atto 488 NHS-ester ATTO-TEC GmbH AD 488–31 Catalase from bovine liver Sigma-Aldrich C1345 Chloroform Sigma-Aldrich Cat#288306 Cy-3B Mono NHS-ester Cytiva PA63101 Cysteamine Sigma-Aldrich Cat#30070 DY-749P1 NHS-ester Dyomics GmnH Cat#749P1-01 Dulbecco’s Phosphate Buffered Saline Sigma-Aldrich D8662 Ethanol Pharmco Cat#111000200C1GL FluoSpheres Infrared (715/755) Invitrogen Cat#F8799 FluoSpheres Orange (540/560) Invitrogen Cat#F8809 D-(+)-Glucose Sigma Aldrich Cat#G7528 Glucose Oxidase Sigma-Aldrich G2133 Glutaraldehyde 70%, EM grade Electron Microscopy Sciences Cat#16360 Normal Donkey Serum Jackson ImmunoResearch Cat#017-000-121 Paraformaldehyde 16%, EM grade Electron Microscopy Sciences Cat#15710 Sodium azide Sigma-Aldrich S2002 Sodium chloride Sigma-Aldrich S9888 Sodium hydroxide pellets Sigma-Aldrich Cat#567530 Tris-base (Trizma-base) Sigma-Aldrich T8524 Triton X-100 Sigma-Aldrich Cat#11332481001 Critical commercial assays UltraBed Kit Electron Microscopy Sciences Cat#14310 Experimental models: Organisms/strains Mouse: C57BL/6J Age: 2–8 days; Sex: M/F The Jackson Laboratory Cat#000664 Mouse: b2-nAChR / Age: 2–8 days; Sex: M/F Burbridge et al.104 N/A Oligonucleotides Primer: nAChR forward: CAGGCGTT ATCCACAAAGACAGA Burbridge et al.104 N/A Primer: nAChR reverse: TTGAGGGG AGCAGAACAGAATC Burbridge et al.104 N/A Primer: nAChR mutant reverse: ACTTGGGTTTGGGCGTGTTGAG Burbridge et al.104 N/A (Continued on next page) 14 Cell Reports 42, 112085, February 28, 2023 Article Title: Phosphorylation-dependent membraneless organelle fusion and fission illustrated by postsynaptic density assemblies. Article Snippet: Article Article Title: Presynaptic activity and protein turnover are correlated at the single-synapse level. Article Snippet: REAGENT or Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The blocked membranes from both in vivo and in vitro experiments were probed with following primary antibodies: Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal antiBassoon at 1:1000 ( Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal anti-Bassoon at 1:1000 ( Cell Culture:Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The dilution ratio of primary antibodies was as follows: Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: After sections were washed with PBS (10 min × 2) and blocking solution (20 min × 1), DyLight405 anti-guinea pig (Jackson ImmunoResearch Laboratories), Alexa Fluor 488 anti-chicken (Jackson ImmunoResearch Laboratories), and Alexa Fluor 594 anti-rabbit (Jackson ImmunoResearch Laboratories) were added to samples at a dilution of 1:800 for secondary antibody incubation at room temperature for 1 h. The immunostained slides were mounted with ProLong Gold antifade reagent (Life Technologies) and cured for 24 h. Fluorescent images of immunostained sections were acquired at 5×, 40×, and 63× magnifications with a Zeiss LSM 880 confocal microscope. Article Title: The synaptic basis of activity-dependent eye-specific competition. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Donkey anti-Guinea pig IgG unconjugated (1:100) Jackson ImmunoResearch Cat#706-005-148; RRID: AB_2340443 Donkey anti-Mouse IgG unconjugated (1:100) Jackson ImmunoResearch Cat#715-005-150; RRID: AB_2340758 Donkey anti-Rabbit IgG unconjugated (1:100) Jackson ImmunoResearch Cat#711-005-152; RRID: AB_2340585 Guinea pig polyclonal anit-VGluT2 (1:100) Millipore Sigma AB2251-I; RRID: AB_2665454 Mouse monoclonal anti-Bassoon (1:100) Abcam Ab82958; RRID: AB_1860018 Rabbit polyclonal anti-Homer1 (1:100) Synaptic Systems Cat#160 003; RRID: AB_887730 Chemicals, peptides, and recombinant proteins Alexa Fluor 405 NHS-ester Thermo Fisher Scientific Cat#A30000 Alexa Fluor 647 NHS-ester Thermo Fisher Scientific Cat#A20006 Atto 488 NHS-ester ATTO-TEC GmbH AD 488–31 Catalase from bovine liver Sigma-Aldrich C1345 Chloroform Sigma-Aldrich Cat#288306 Cy-3B Mono NHS-ester Cytiva PA63101 Cysteamine Sigma-Aldrich Cat#30070 DY-749P1 NHS-ester Dyomics GmnH Cat#749P1-01 Dulbecco’s Phosphate Buffered Saline Sigma-Aldrich D8662 Ethanol Pharmco Cat#111000200C1GL FluoSpheres Infrared (715/755) Invitrogen Cat#F8799 FluoSpheres Orange (540/560) Invitrogen Cat#F8809 D-(+)-Glucose Sigma Aldrich Cat#G7528 Glucose Oxidase Sigma-Aldrich G2133 Glutaraldehyde 70%, EM grade Electron Microscopy Sciences Cat#16360 Normal Donkey Serum Jackson ImmunoResearch Cat#017-000-121 Paraformaldehyde 16%, EM grade Electron Microscopy Sciences Cat#15710 Sodium azide Sigma-Aldrich S2002 Sodium chloride Sigma-Aldrich S9888 Sodium hydroxide pellets Sigma-Aldrich Cat#567530 Tris-base (Trizma-base) Sigma-Aldrich T8524 Triton X-100 Sigma-Aldrich Cat#11332481001 Critical commercial assays UltraBed Kit Electron Microscopy Sciences Cat#14310 Experimental models: Organisms/strains Mouse: C57BL/6J Age: 2–8 days; Sex: M/F The Jackson Laboratory Cat#000664 Mouse: b2-nAChR / Age: 2–8 days; Sex: M/F Burbridge et al.104 N/A Oligonucleotides Primer: nAChR forward: CAGGCGTT ATCCACAAAGACAGA Burbridge et al.104 N/A Primer: nAChR reverse: TTGAGGGG AGCAGAACAGAATC Burbridge et al.104 N/A Primer: nAChR mutant reverse: ACTTGGGTTTGGGCGTGTTGAG Burbridge et al.104 N/A (Continued on next page) 14 Cell Reports 42, 112085, February 28, 2023 Article Title: Phosphorylation-dependent membraneless organelle fusion and fission illustrated by postsynaptic density assemblies. Article Snippet: Article Article Title: Presynaptic activity and protein turnover are correlated at the single-synapse level. Article Snippet: REAGENT or Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The blocked membranes from both in vivo and in vitro experiments were probed with following primary antibodies: Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal antiBassoon at 1:1000 ( Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal anti-Bassoon at 1:1000 ( Incubation:Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The dilution ratio of primary antibodies was as follows: Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: After sections were washed with PBS (10 min × 2) and blocking solution (20 min × 1), DyLight405 anti-guinea pig (Jackson ImmunoResearch Laboratories), Alexa Fluor 488 anti-chicken (Jackson ImmunoResearch Laboratories), and Alexa Fluor 594 anti-rabbit (Jackson ImmunoResearch Laboratories) were added to samples at a dilution of 1:800 for secondary antibody incubation at room temperature for 1 h. The immunostained slides were mounted with ProLong Gold antifade reagent (Life Technologies) and cured for 24 h. Fluorescent images of immunostained sections were acquired at 5×, 40×, and 63× magnifications with a Zeiss LSM 880 confocal microscope. Article Title: The synaptic basis of activity-dependent eye-specific competition. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Donkey anti-Guinea pig IgG unconjugated (1:100) Jackson ImmunoResearch Cat#706-005-148; RRID: AB_2340443 Donkey anti-Mouse IgG unconjugated (1:100) Jackson ImmunoResearch Cat#715-005-150; RRID: AB_2340758 Donkey anti-Rabbit IgG unconjugated (1:100) Jackson ImmunoResearch Cat#711-005-152; RRID: AB_2340585 Guinea pig polyclonal anit-VGluT2 (1:100) Millipore Sigma AB2251-I; RRID: AB_2665454 Mouse monoclonal anti-Bassoon (1:100) Abcam Ab82958; RRID: AB_1860018 Rabbit polyclonal anti-Homer1 (1:100) Synaptic Systems Cat#160 003; RRID: AB_887730 Chemicals, peptides, and recombinant proteins Alexa Fluor 405 NHS-ester Thermo Fisher Scientific Cat#A30000 Alexa Fluor 647 NHS-ester Thermo Fisher Scientific Cat#A20006 Atto 488 NHS-ester ATTO-TEC GmbH AD 488–31 Catalase from bovine liver Sigma-Aldrich C1345 Chloroform Sigma-Aldrich Cat#288306 Cy-3B Mono NHS-ester Cytiva PA63101 Cysteamine Sigma-Aldrich Cat#30070 DY-749P1 NHS-ester Dyomics GmnH Cat#749P1-01 Dulbecco’s Phosphate Buffered Saline Sigma-Aldrich D8662 Ethanol Pharmco Cat#111000200C1GL FluoSpheres Infrared (715/755) Invitrogen Cat#F8799 FluoSpheres Orange (540/560) Invitrogen Cat#F8809 D-(+)-Glucose Sigma Aldrich Cat#G7528 Glucose Oxidase Sigma-Aldrich G2133 Glutaraldehyde 70%, EM grade Electron Microscopy Sciences Cat#16360 Normal Donkey Serum Jackson ImmunoResearch Cat#017-000-121 Paraformaldehyde 16%, EM grade Electron Microscopy Sciences Cat#15710 Sodium azide Sigma-Aldrich S2002 Sodium chloride Sigma-Aldrich S9888 Sodium hydroxide pellets Sigma-Aldrich Cat#567530 Tris-base (Trizma-base) Sigma-Aldrich T8524 Triton X-100 Sigma-Aldrich Cat#11332481001 Critical commercial assays UltraBed Kit Electron Microscopy Sciences Cat#14310 Experimental models: Organisms/strains Mouse: C57BL/6J Age: 2–8 days; Sex: M/F The Jackson Laboratory Cat#000664 Mouse: b2-nAChR / Age: 2–8 days; Sex: M/F Burbridge et al.104 N/A Oligonucleotides Primer: nAChR forward: CAGGCGTT ATCCACAAAGACAGA Burbridge et al.104 N/A Primer: nAChR reverse: TTGAGGGG AGCAGAACAGAATC Burbridge et al.104 N/A Primer: nAChR mutant reverse: ACTTGGGTTTGGGCGTGTTGAG Burbridge et al.104 N/A (Continued on next page) 14 Cell Reports 42, 112085, February 28, 2023 Article Title: Phosphorylation-dependent membraneless organelle fusion and fission illustrated by postsynaptic density assemblies. Article Snippet: Article Article Title: Presynaptic activity and protein turnover are correlated at the single-synapse level. Article Snippet: REAGENT or Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The blocked membranes from both in vivo and in vitro experiments were probed with following primary antibodies: Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal antiBassoon at 1:1000 ( Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal anti-Bassoon at 1:1000 ( Negative Control:Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The dilution ratio of primary antibodies was as follows: Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: After sections were washed with PBS (10 min × 2) and blocking solution (20 min × 1), DyLight405 anti-guinea pig (Jackson ImmunoResearch Laboratories), Alexa Fluor 488 anti-chicken (Jackson ImmunoResearch Laboratories), and Alexa Fluor 594 anti-rabbit (Jackson ImmunoResearch Laboratories) were added to samples at a dilution of 1:800 for secondary antibody incubation at room temperature for 1 h. The immunostained slides were mounted with ProLong Gold antifade reagent (Life Technologies) and cured for 24 h. Fluorescent images of immunostained sections were acquired at 5×, 40×, and 63× magnifications with a Zeiss LSM 880 confocal microscope. Article Title: The synaptic basis of activity-dependent eye-specific competition. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Donkey anti-Guinea pig IgG unconjugated (1:100) Jackson ImmunoResearch Cat#706-005-148; RRID: AB_2340443 Donkey anti-Mouse IgG unconjugated (1:100) Jackson ImmunoResearch Cat#715-005-150; RRID: AB_2340758 Donkey anti-Rabbit IgG unconjugated (1:100) Jackson ImmunoResearch Cat#711-005-152; RRID: AB_2340585 Guinea pig polyclonal anit-VGluT2 (1:100) Millipore Sigma AB2251-I; RRID: AB_2665454 Mouse monoclonal anti-Bassoon (1:100) Abcam Ab82958; RRID: AB_1860018 Rabbit polyclonal anti-Homer1 (1:100) Synaptic Systems Cat#160 003; RRID: AB_887730 Chemicals, peptides, and recombinant proteins Alexa Fluor 405 NHS-ester Thermo Fisher Scientific Cat#A30000 Alexa Fluor 647 NHS-ester Thermo Fisher Scientific Cat#A20006 Atto 488 NHS-ester ATTO-TEC GmbH AD 488–31 Catalase from bovine liver Sigma-Aldrich C1345 Chloroform Sigma-Aldrich Cat#288306 Cy-3B Mono NHS-ester Cytiva PA63101 Cysteamine Sigma-Aldrich Cat#30070 DY-749P1 NHS-ester Dyomics GmnH Cat#749P1-01 Dulbecco’s Phosphate Buffered Saline Sigma-Aldrich D8662 Ethanol Pharmco Cat#111000200C1GL FluoSpheres Infrared (715/755) Invitrogen Cat#F8799 FluoSpheres Orange (540/560) Invitrogen Cat#F8809 D-(+)-Glucose Sigma Aldrich Cat#G7528 Glucose Oxidase Sigma-Aldrich G2133 Glutaraldehyde 70%, EM grade Electron Microscopy Sciences Cat#16360 Normal Donkey Serum Jackson ImmunoResearch Cat#017-000-121 Paraformaldehyde 16%, EM grade Electron Microscopy Sciences Cat#15710 Sodium azide Sigma-Aldrich S2002 Sodium chloride Sigma-Aldrich S9888 Sodium hydroxide pellets Sigma-Aldrich Cat#567530 Tris-base (Trizma-base) Sigma-Aldrich T8524 Triton X-100 Sigma-Aldrich Cat#11332481001 Critical commercial assays UltraBed Kit Electron Microscopy Sciences Cat#14310 Experimental models: Organisms/strains Mouse: C57BL/6J Age: 2–8 days; Sex: M/F The Jackson Laboratory Cat#000664 Mouse: b2-nAChR / Age: 2–8 days; Sex: M/F Burbridge et al.104 N/A Oligonucleotides Primer: nAChR forward: CAGGCGTT ATCCACAAAGACAGA Burbridge et al.104 N/A Primer: nAChR reverse: TTGAGGGG AGCAGAACAGAATC Burbridge et al.104 N/A Primer: nAChR mutant reverse: ACTTGGGTTTGGGCGTGTTGAG Burbridge et al.104 N/A (Continued on next page) 14 Cell Reports 42, 112085, February 28, 2023 Article Title: Phosphorylation-dependent membraneless organelle fusion and fission illustrated by postsynaptic density assemblies. Article Snippet: Article Article Title: Presynaptic activity and protein turnover are correlated at the single-synapse level. Article Snippet: REAGENT or Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The blocked membranes from both in vivo and in vitro experiments were probed with following primary antibodies: Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal antiBassoon at 1:1000 ( Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal anti-Bassoon at 1:1000 ( Transmission Assay:Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The dilution ratio of primary antibodies was as follows: Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: After sections were washed with PBS (10 min × 2) and blocking solution (20 min × 1), DyLight405 anti-guinea pig (Jackson ImmunoResearch Laboratories), Alexa Fluor 488 anti-chicken (Jackson ImmunoResearch Laboratories), and Alexa Fluor 594 anti-rabbit (Jackson ImmunoResearch Laboratories) were added to samples at a dilution of 1:800 for secondary antibody incubation at room temperature for 1 h. The immunostained slides were mounted with ProLong Gold antifade reagent (Life Technologies) and cured for 24 h. Fluorescent images of immunostained sections were acquired at 5×, 40×, and 63× magnifications with a Zeiss LSM 880 confocal microscope. Article Title: The synaptic basis of activity-dependent eye-specific competition. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Donkey anti-Guinea pig IgG unconjugated (1:100) Jackson ImmunoResearch Cat#706-005-148; RRID: AB_2340443 Donkey anti-Mouse IgG unconjugated (1:100) Jackson ImmunoResearch Cat#715-005-150; RRID: AB_2340758 Donkey anti-Rabbit IgG unconjugated (1:100) Jackson ImmunoResearch Cat#711-005-152; RRID: AB_2340585 Guinea pig polyclonal anit-VGluT2 (1:100) Millipore Sigma AB2251-I; RRID: AB_2665454 Mouse monoclonal anti-Bassoon (1:100) Abcam Ab82958; RRID: AB_1860018 Rabbit polyclonal anti-Homer1 (1:100) Synaptic Systems Cat#160 003; RRID: AB_887730 Chemicals, peptides, and recombinant proteins Alexa Fluor 405 NHS-ester Thermo Fisher Scientific Cat#A30000 Alexa Fluor 647 NHS-ester Thermo Fisher Scientific Cat#A20006 Atto 488 NHS-ester ATTO-TEC GmbH AD 488–31 Catalase from bovine liver Sigma-Aldrich C1345 Chloroform Sigma-Aldrich Cat#288306 Cy-3B Mono NHS-ester Cytiva PA63101 Cysteamine Sigma-Aldrich Cat#30070 DY-749P1 NHS-ester Dyomics GmnH Cat#749P1-01 Dulbecco’s Phosphate Buffered Saline Sigma-Aldrich D8662 Ethanol Pharmco Cat#111000200C1GL FluoSpheres Infrared (715/755) Invitrogen Cat#F8799 FluoSpheres Orange (540/560) Invitrogen Cat#F8809 D-(+)-Glucose Sigma Aldrich Cat#G7528 Glucose Oxidase Sigma-Aldrich G2133 Glutaraldehyde 70%, EM grade Electron Microscopy Sciences Cat#16360 Normal Donkey Serum Jackson ImmunoResearch Cat#017-000-121 Paraformaldehyde 16%, EM grade Electron Microscopy Sciences Cat#15710 Sodium azide Sigma-Aldrich S2002 Sodium chloride Sigma-Aldrich S9888 Sodium hydroxide pellets Sigma-Aldrich Cat#567530 Tris-base (Trizma-base) Sigma-Aldrich T8524 Triton X-100 Sigma-Aldrich Cat#11332481001 Critical commercial assays UltraBed Kit Electron Microscopy Sciences Cat#14310 Experimental models: Organisms/strains Mouse: C57BL/6J Age: 2–8 days; Sex: M/F The Jackson Laboratory Cat#000664 Mouse: b2-nAChR / Age: 2–8 days; Sex: M/F Burbridge et al.104 N/A Oligonucleotides Primer: nAChR forward: CAGGCGTT ATCCACAAAGACAGA Burbridge et al.104 N/A Primer: nAChR reverse: TTGAGGGG AGCAGAACAGAATC Burbridge et al.104 N/A Primer: nAChR mutant reverse: ACTTGGGTTTGGGCGTGTTGAG Burbridge et al.104 N/A (Continued on next page) 14 Cell Reports 42, 112085, February 28, 2023 Article Title: Phosphorylation-dependent membraneless organelle fusion and fission illustrated by postsynaptic density assemblies. Article Snippet: Article Article Title: Presynaptic activity and protein turnover are correlated at the single-synapse level. Article Snippet: REAGENT or Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The blocked membranes from both in vivo and in vitro experiments were probed with following primary antibodies: Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal antiBassoon at 1:1000 ( Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal anti-Bassoon at 1:1000 ( Patch Clamp:Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The dilution ratio of primary antibodies was as follows: Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: After sections were washed with PBS (10 min × 2) and blocking solution (20 min × 1), DyLight405 anti-guinea pig (Jackson ImmunoResearch Laboratories), Alexa Fluor 488 anti-chicken (Jackson ImmunoResearch Laboratories), and Alexa Fluor 594 anti-rabbit (Jackson ImmunoResearch Laboratories) were added to samples at a dilution of 1:800 for secondary antibody incubation at room temperature for 1 h. The immunostained slides were mounted with ProLong Gold antifade reagent (Life Technologies) and cured for 24 h. Fluorescent images of immunostained sections were acquired at 5×, 40×, and 63× magnifications with a Zeiss LSM 880 confocal microscope. Article Title: The synaptic basis of activity-dependent eye-specific competition. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Donkey anti-Guinea pig IgG unconjugated (1:100) Jackson ImmunoResearch Cat#706-005-148; RRID: AB_2340443 Donkey anti-Mouse IgG unconjugated (1:100) Jackson ImmunoResearch Cat#715-005-150; RRID: AB_2340758 Donkey anti-Rabbit IgG unconjugated (1:100) Jackson ImmunoResearch Cat#711-005-152; RRID: AB_2340585 Guinea pig polyclonal anit-VGluT2 (1:100) Millipore Sigma AB2251-I; RRID: AB_2665454 Mouse monoclonal anti-Bassoon (1:100) Abcam Ab82958; RRID: AB_1860018 Rabbit polyclonal anti-Homer1 (1:100) Synaptic Systems Cat#160 003; RRID: AB_887730 Chemicals, peptides, and recombinant proteins Alexa Fluor 405 NHS-ester Thermo Fisher Scientific Cat#A30000 Alexa Fluor 647 NHS-ester Thermo Fisher Scientific Cat#A20006 Atto 488 NHS-ester ATTO-TEC GmbH AD 488–31 Catalase from bovine liver Sigma-Aldrich C1345 Chloroform Sigma-Aldrich Cat#288306 Cy-3B Mono NHS-ester Cytiva PA63101 Cysteamine Sigma-Aldrich Cat#30070 DY-749P1 NHS-ester Dyomics GmnH Cat#749P1-01 Dulbecco’s Phosphate Buffered Saline Sigma-Aldrich D8662 Ethanol Pharmco Cat#111000200C1GL FluoSpheres Infrared (715/755) Invitrogen Cat#F8799 FluoSpheres Orange (540/560) Invitrogen Cat#F8809 D-(+)-Glucose Sigma Aldrich Cat#G7528 Glucose Oxidase Sigma-Aldrich G2133 Glutaraldehyde 70%, EM grade Electron Microscopy Sciences Cat#16360 Normal Donkey Serum Jackson ImmunoResearch Cat#017-000-121 Paraformaldehyde 16%, EM grade Electron Microscopy Sciences Cat#15710 Sodium azide Sigma-Aldrich S2002 Sodium chloride Sigma-Aldrich S9888 Sodium hydroxide pellets Sigma-Aldrich Cat#567530 Tris-base (Trizma-base) Sigma-Aldrich T8524 Triton X-100 Sigma-Aldrich Cat#11332481001 Critical commercial assays UltraBed Kit Electron Microscopy Sciences Cat#14310 Experimental models: Organisms/strains Mouse: C57BL/6J Age: 2–8 days; Sex: M/F The Jackson Laboratory Cat#000664 Mouse: b2-nAChR / Age: 2–8 days; Sex: M/F Burbridge et al.104 N/A Oligonucleotides Primer: nAChR forward: CAGGCGTT ATCCACAAAGACAGA Burbridge et al.104 N/A Primer: nAChR reverse: TTGAGGGG AGCAGAACAGAATC Burbridge et al.104 N/A Primer: nAChR mutant reverse: ACTTGGGTTTGGGCGTGTTGAG Burbridge et al.104 N/A (Continued on next page) 14 Cell Reports 42, 112085, February 28, 2023 Article Title: Phosphorylation-dependent membraneless organelle fusion and fission illustrated by postsynaptic density assemblies. Article Snippet: Article Article Title: Presynaptic activity and protein turnover are correlated at the single-synapse level. Article Snippet: REAGENT or Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The blocked membranes from both in vivo and in vitro experiments were probed with following primary antibodies: Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal antiBassoon at 1:1000 ( Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal anti-Bassoon at 1:1000 ( Expressing:Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The dilution ratio of primary antibodies was as follows: Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: After sections were washed with PBS (10 min × 2) and blocking solution (20 min × 1), DyLight405 anti-guinea pig (Jackson ImmunoResearch Laboratories), Alexa Fluor 488 anti-chicken (Jackson ImmunoResearch Laboratories), and Alexa Fluor 594 anti-rabbit (Jackson ImmunoResearch Laboratories) were added to samples at a dilution of 1:800 for secondary antibody incubation at room temperature for 1 h. The immunostained slides were mounted with ProLong Gold antifade reagent (Life Technologies) and cured for 24 h. Fluorescent images of immunostained sections were acquired at 5×, 40×, and 63× magnifications with a Zeiss LSM 880 confocal microscope. Article Title: The synaptic basis of activity-dependent eye-specific competition. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Donkey anti-Guinea pig IgG unconjugated (1:100) Jackson ImmunoResearch Cat#706-005-148; RRID: AB_2340443 Donkey anti-Mouse IgG unconjugated (1:100) Jackson ImmunoResearch Cat#715-005-150; RRID: AB_2340758 Donkey anti-Rabbit IgG unconjugated (1:100) Jackson ImmunoResearch Cat#711-005-152; RRID: AB_2340585 Guinea pig polyclonal anit-VGluT2 (1:100) Millipore Sigma AB2251-I; RRID: AB_2665454 Mouse monoclonal anti-Bassoon (1:100) Abcam Ab82958; RRID: AB_1860018 Rabbit polyclonal anti-Homer1 (1:100) Synaptic Systems Cat#160 003; RRID: AB_887730 Chemicals, peptides, and recombinant proteins Alexa Fluor 405 NHS-ester Thermo Fisher Scientific Cat#A30000 Alexa Fluor 647 NHS-ester Thermo Fisher Scientific Cat#A20006 Atto 488 NHS-ester ATTO-TEC GmbH AD 488–31 Catalase from bovine liver Sigma-Aldrich C1345 Chloroform Sigma-Aldrich Cat#288306 Cy-3B Mono NHS-ester Cytiva PA63101 Cysteamine Sigma-Aldrich Cat#30070 DY-749P1 NHS-ester Dyomics GmnH Cat#749P1-01 Dulbecco’s Phosphate Buffered Saline Sigma-Aldrich D8662 Ethanol Pharmco Cat#111000200C1GL FluoSpheres Infrared (715/755) Invitrogen Cat#F8799 FluoSpheres Orange (540/560) Invitrogen Cat#F8809 D-(+)-Glucose Sigma Aldrich Cat#G7528 Glucose Oxidase Sigma-Aldrich G2133 Glutaraldehyde 70%, EM grade Electron Microscopy Sciences Cat#16360 Normal Donkey Serum Jackson ImmunoResearch Cat#017-000-121 Paraformaldehyde 16%, EM grade Electron Microscopy Sciences Cat#15710 Sodium azide Sigma-Aldrich S2002 Sodium chloride Sigma-Aldrich S9888 Sodium hydroxide pellets Sigma-Aldrich Cat#567530 Tris-base (Trizma-base) Sigma-Aldrich T8524 Triton X-100 Sigma-Aldrich Cat#11332481001 Critical commercial assays UltraBed Kit Electron Microscopy Sciences Cat#14310 Experimental models: Organisms/strains Mouse: C57BL/6J Age: 2–8 days; Sex: M/F The Jackson Laboratory Cat#000664 Mouse: b2-nAChR / Age: 2–8 days; Sex: M/F Burbridge et al.104 N/A Oligonucleotides Primer: nAChR forward: CAGGCGTT ATCCACAAAGACAGA Burbridge et al.104 N/A Primer: nAChR reverse: TTGAGGGG AGCAGAACAGAATC Burbridge et al.104 N/A Primer: nAChR mutant reverse: ACTTGGGTTTGGGCGTGTTGAG Burbridge et al.104 N/A (Continued on next page) 14 Cell Reports 42, 112085, February 28, 2023 Article Title: Phosphorylation-dependent membraneless organelle fusion and fission illustrated by postsynaptic density assemblies. Article Snippet: Article Article Title: Presynaptic activity and protein turnover are correlated at the single-synapse level. Article Snippet: REAGENT or Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The blocked membranes from both in vivo and in vitro experiments were probed with following primary antibodies: Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal antiBassoon at 1:1000 ( Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal anti-Bassoon at 1:1000 ( Concentration Assay:Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The dilution ratio of primary antibodies was as follows: Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: After sections were washed with PBS (10 min × 2) and blocking solution (20 min × 1), DyLight405 anti-guinea pig (Jackson ImmunoResearch Laboratories), Alexa Fluor 488 anti-chicken (Jackson ImmunoResearch Laboratories), and Alexa Fluor 594 anti-rabbit (Jackson ImmunoResearch Laboratories) were added to samples at a dilution of 1:800 for secondary antibody incubation at room temperature for 1 h. The immunostained slides were mounted with ProLong Gold antifade reagent (Life Technologies) and cured for 24 h. Fluorescent images of immunostained sections were acquired at 5×, 40×, and 63× magnifications with a Zeiss LSM 880 confocal microscope. Article Title: The synaptic basis of activity-dependent eye-specific competition. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Donkey anti-Guinea pig IgG unconjugated (1:100) Jackson ImmunoResearch Cat#706-005-148; RRID: AB_2340443 Donkey anti-Mouse IgG unconjugated (1:100) Jackson ImmunoResearch Cat#715-005-150; RRID: AB_2340758 Donkey anti-Rabbit IgG unconjugated (1:100) Jackson ImmunoResearch Cat#711-005-152; RRID: AB_2340585 Guinea pig polyclonal anit-VGluT2 (1:100) Millipore Sigma AB2251-I; RRID: AB_2665454 Mouse monoclonal anti-Bassoon (1:100) Abcam Ab82958; RRID: AB_1860018 Rabbit polyclonal anti-Homer1 (1:100) Synaptic Systems Cat#160 003; RRID: AB_887730 Chemicals, peptides, and recombinant proteins Alexa Fluor 405 NHS-ester Thermo Fisher Scientific Cat#A30000 Alexa Fluor 647 NHS-ester Thermo Fisher Scientific Cat#A20006 Atto 488 NHS-ester ATTO-TEC GmbH AD 488–31 Catalase from bovine liver Sigma-Aldrich C1345 Chloroform Sigma-Aldrich Cat#288306 Cy-3B Mono NHS-ester Cytiva PA63101 Cysteamine Sigma-Aldrich Cat#30070 DY-749P1 NHS-ester Dyomics GmnH Cat#749P1-01 Dulbecco’s Phosphate Buffered Saline Sigma-Aldrich D8662 Ethanol Pharmco Cat#111000200C1GL FluoSpheres Infrared (715/755) Invitrogen Cat#F8799 FluoSpheres Orange (540/560) Invitrogen Cat#F8809 D-(+)-Glucose Sigma Aldrich Cat#G7528 Glucose Oxidase Sigma-Aldrich G2133 Glutaraldehyde 70%, EM grade Electron Microscopy Sciences Cat#16360 Normal Donkey Serum Jackson ImmunoResearch Cat#017-000-121 Paraformaldehyde 16%, EM grade Electron Microscopy Sciences Cat#15710 Sodium azide Sigma-Aldrich S2002 Sodium chloride Sigma-Aldrich S9888 Sodium hydroxide pellets Sigma-Aldrich Cat#567530 Tris-base (Trizma-base) Sigma-Aldrich T8524 Triton X-100 Sigma-Aldrich Cat#11332481001 Critical commercial assays UltraBed Kit Electron Microscopy Sciences Cat#14310 Experimental models: Organisms/strains Mouse: C57BL/6J Age: 2–8 days; Sex: M/F The Jackson Laboratory Cat#000664 Mouse: b2-nAChR / Age: 2–8 days; Sex: M/F Burbridge et al.104 N/A Oligonucleotides Primer: nAChR forward: CAGGCGTT ATCCACAAAGACAGA Burbridge et al.104 N/A Primer: nAChR reverse: TTGAGGGG AGCAGAACAGAATC Burbridge et al.104 N/A Primer: nAChR mutant reverse: ACTTGGGTTTGGGCGTGTTGAG Burbridge et al.104 N/A (Continued on next page) 14 Cell Reports 42, 112085, February 28, 2023 Article Title: Phosphorylation-dependent membraneless organelle fusion and fission illustrated by postsynaptic density assemblies. Article Snippet: Article Article Title: Presynaptic activity and protein turnover are correlated at the single-synapse level. Article Snippet: REAGENT or Article Title: Characterization of Brain Dysfunction Induced by Bacterial Lipopeptides That Alter Neuronal Activity and Network in Rodent Brains Article Snippet: The blocked membranes from both in vivo and in vitro experiments were probed with following primary antibodies: Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal antiBassoon at 1:1000 ( Article Title: Auxiliary α2δ1 and α2δ3 Subunits of Calcium Channels Drive Excitatory and Inhibitory Neuronal Network Development Article Snippet: The following primary antibodies were used: rat anti-HA 1:1000 (Roche, catalog #11867423001, clone 3F10), mouse anti-HA at 1:1000 (Covance, catalog #MMS-101P, clone 16B12), guinea pig polyclonal anti-Bassoon at 1:1000 ( |
